Article Per Year (5 Year)
p-Index From 2020 - 2025
7.897
P-Index
This Author published in this journals
All Journal Bioscience AL KAUNIYAH Jurnal Penelitian Pendidikan IPA (JPPIPA) Jurnal Biologi Tropis EKSAKTA : Jurnal Penelitian dan Pembelajaran MIPA Indonesian Food Science and TechnologyJournal Martabe : Jurnal Pengabdian Kepada Masyarakat JURNAL PENDIDIKAN TAMBUSAI Pelita Eksakta Jurnal Biogenerasi Journal of halal product and research (JHPR) 3BIO: Journal of Biological Science, Technology and Management Jurnal Jeumpa Halal Research Journal TROPICAL GENETICS MASALIQ: Jurnal Pendidikan dan Sains Promotor: Jurnal Mahasiswa Kesehatan Masyarakat Tropical Genetics Symbiotic: Journal of Biological Education and Science Jurnal Serambi Biologi
Achyar, Afifatul
Departemen Biologi, Fakultas Matematika Dan Ilmu Pengetahuan Alam, Universitas Negeri Padang, Padang Indonesia
Religion Agriculture, Biological Sciences & Forestry Arts Humanities Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Decision Sciences, Operations Research & Management Dentistry Economics, Econometrics & Finance Education Engineering Environmental Science Immunology & microbiology Languange, Linguistic, Communication & Media Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Neuroscience Nursing Physics Public Health Social Sciences Veterinary Other

Published : 59 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 7 Documents
Search
Journal : Jurnal Serambi Biologi

 1 
Analysis of Genetic Variations in PHT1 Gene Sequences in Rice (Oryza sativa) NCBI Popset 240028097 Using In-Silico RFLP Oliv Nurul Kanaya Nurul Kanaya; Afifatul Achyar
Jurnal Serambi Biologi Vol. 8 No. 1 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Abstract Rice is a plant that has high economic value. According to FAO, Indonesia is the third largest rice consuming country in the world. However, rice will become stunted and its growth will be stunted if there is a lack of phosphorus. The PHT1 gene plays an important role in plant growth and development, because this gene plays a role in taking phosphate from the soil. The PHT1 gene is transcribed when there is drought, salt stress, and nutrition in plants. Genetic variation in a population will affect the survival of an individual. This study used the restriction enzyme ScaI. This study aims to analyze genetic variation in the PHT1 gene sequence in NCBI Popset 2400280979 rice using RFLP in silico. The results showed that there was genetic variation in the rice PHT1 gene sequence and two allele variations present in 24 rice gene sequences using the restriction enzyme ScaI.
Specific Primer Design and Optimization of Monodehydroascorbate reductase (MDHAR) Gene Amplification in Rice (Oryza sativa L.) Jumatul Hafsah; Afifatul Achyar; Zulyusri; Yusni Atifah; Linda Advinda; Violita
Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Monodehydroascorbate reductase (MDHAR) is an enzyme responsible for growth and response to biotic and abiotic stress. MDHAR in rice shows a higher sensitivity to stress compared to other plants. This study aims to obtain specific primers for the MDHAR gene in rice to be used in PCR amplification so that it can amplify the MDHAR gene. Primers are designed using the Pickprimer and Geneious Primer tools. Optimization of annealing temperature was carried out using the gradient PCR method and then an in vitro primary specification test was carried out using the Touchdown PCR method. The results of the primary design obtained one candidate primer that met the ideal primer requirements, namely a pair of primers (5'-AAAAACACTGCATGGGTCGTC-3' and 5'-CGCCTACCGTTTCCCAAGTT-3') with an amplicon length of 160 bp. The visualization results of PCR products using 1.5% agarose showed that 6 samples were able to amplify the MDHAR gene at 160 bp in size. However, in each lane there is a non-specific DNA band (Primer dimer). In vitro primer specification testing with Touchdown succeeded in increasing product formation specifications and was able to reduce non-specific DNA bands (Primer dimers).
Primer Design and Annealing Temperature Optimization for Catalase (CAT) Gene Amplification in Rice (Oryza sativa L.) Yulita, Nelfi; Violita; Achyar, Afifatul; Putri, Dwi Hilda
Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i3.222

Abstract

Catalase (CAT) is an antioxidant enzyme that plays an important role in plant growht and defense against abiotic stress, one of which is rice (Oryza sativa). When plants are under abiotic stress conditions, the CAT gene will be regulated and expressed as a form of defense response to stress. To determine the expression of this CAT gene, optimal primers and annealing temperatures are needed to spesifically amplify the CAT gene. This study aims to design primers and determine the optimal annealing temperatures to amplify the CAT gene. Primers are designed using the tools pick primer, primer BLAST and geneious prime. Primers are designed in silico and must meet the ideal primer criteria because they will be used in vitro. Optimization of the annealing temperature was carried out using a PCR temperature gradient. The results of this study obtained a pair of primers, namely forward primer 5’-ATAAGTAGGGCGGTGTGTGG-3’ with a primer length of 20 bp, and reverse primer 5’-GCGAGTTGTTGTTGTTCCATAC-3’ with a primer length 22 bp. This primer pair produces a 185 bp amplicon in the Oryza sativa CAT gene. The optimum annealing temperature for this primer pair is 60ºC.
Primary Design and Optimization of Dehydroascorbate reductase (DHAR) Gene Amplification in Oryza sativa L. Putri, Isna Aryunita Putri; Achyar, Afifatul; Zulzusri, Zulzusri; Atifah, Yusni; Putri, Dwi Hilda; Violita, Violita
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.230

Abstract

Dehydroascorbate reductase (DHAR) is one of the antioxidant enzymes involved in ascorbate recycling which catalyzes the reduction of oxidized ascorbate. DHAR is responsible for regenerating AsA from its oxidized state and regulating the redox state of cellular AsA which ultimately influences cell response and tolerance to ROS. DHAR is important for plant growth because it plays a role in the recycling of AsA. Rice is a plant that is sensitive to drought stress, one of the defense mechanisms of plants in dealing with drought stress is to activate the DHAR gene. The method that can be used to amplify the Dehydroascorbate reductase (DHAR) gene is by qRT-PCR. This method requires specific primers for the target gene. However, for now, the primary design of the DHAR gene is unknown. This study aims to design suitable primers for the amplification of DHAR target genes using the qRT-PCR technique, and to determine the optimal annealing temperature. Primer design was carried out using the PrimerQuest program, then viewed and then analyzed using GeneiousPrime, after which it was checked for specificity with primerBLAST. The primary design results with the best criteria were Forward DHAR 5'-GTACCCAACCCCGTCTCTTG -3' and Reverse DHAR 5'- TGGTAGAGCTTTGGTGCCAG -3' primers with a product size of 228 bp with an optimal temperature for PCR of 60ºC.
Optimasi Deteksi Kontaminasi Daging Babi Berbasis Multiplex Real Time Polymerase Chain Reaction (qPCR) pada Produk Makanan Olahan Daging Sapi Pramila, Cindy; Achyar, Afifatul
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.239

Abstract

Abstrak. Indonesia merupakan salah satu negara dengan mayoritas penduduk beragama Islam. Mengonsumsi pangan yang halal adalah hak dasar setiap muslim. Sampai saat ini harga daging sapi masih relatif mahal. Konsekuensi dari mahalnya harga daging tersebut yaitu ada oknum yang mencampur atau mengganti daging sapi dengan daging hewan lain seperti daging babi. Produk pangan yang dibuat dengan campuran daging sangat sulit dibedakan dengan mata telanjang. Metode Multiplex Real Time PCR merupakan metode pengujian yang cepat, sensitif, dan spesifik untuk mendeteksi kontaminasi daging babi pada produk pangan olahan daging sapi. Hasil penelitian menunjukkan konsentrasi primer yang optimum untuk pasangan primer Bos dan Sus adalah 0,4 μM. Konsentrasi DNA yang optimum untuk mengamplifikasi DNA Bos taurus dan Sus scrofa yaitu pada konsentrasi 100 ng/ μl yang menghasilkan amplikon dengan nilai peak 86,3 o C untuk Bos taurus dan 84,7 oCpada Sus scrofa. Kata kunci optimasi Multiplex Real Time PCR, gen ND5, babi, daging sapi, halal
Optimasi Isolasi DNA Bakteri Patogen pada Sampel Air Sungai Berbasis PCR Putri, Ananda; Achyar, Afifatul
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.241

Abstract

Abstrak Bakteri patogen adalah mikroorganisme yang menyebabkan penyakit pada inangnya dengan berbagai proses yang secara jelas melalui kerusakan langsung jaringan atau sel selama replikasi, melalui produksi toksin yang memungkinkan patogen mencapai jaringan baru atau keluar dari sel pada tempat bereplikasi. Bakteri patogen seperti E.coli dapat tersebar melalui air sungai karena sungai banyak dijadikan sebagai tempat pembuangan kotoran dan sampah sehingga menjadi penyebaran bakteri patogen. Penelitian ini bertujuan untuk mengetahui optimasi isolasi DNA dan mendeteksi bakteri patogen pada sampel air sungai. Metodologi yang digunakan dalam penelitian ini adalah pengambilan sampel air sungai gangga di sekitar Laboratorium Biologi Fakultas Matematika dan Ilmu Pengetahuan Alam Universitas Negeri Padang dan dilakukan analisis laboratorium. Hasil penelitian dari optimasi sampel air sungai gangga bahwa primer yang optimal untuk mendeteksi bakteri patogen adalah primer ESS. Primer ESS berpotensi mengamplikasi bakteri E.coli, Salmonella, dan, Shigella dengan ukuran amplikon 825 bp. Optimasi isolasi lebih optimal saat sampel dimasukkan kedalam microtube .
Genetic Variation Analysis of the E6 HPV 16 Gene Using RFLP In Silico Annisa, Silvy; Rahmawati, Atika Ayu; Nadira; Khairani, Fidia Aura; Achyar, Afifatul
Jurnal Serambi Biologi Vol. 9 No. 1 (2024): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v9i1.331

Abstract

Cervical cancer is cancer that attacks epithelial cells or the outer surface layer of the cervix. This cancer is most commonly caused by the high risk type of Human Papillomavirus. The RFLP method uses restriction enzymes to cut certain nucleotide sequences at specific positions that produce fragments of different lengths. The purpose of this study was to determine the polymorphism that occurs in the E6 gene of the HPV 16 virus. This research was conducted using RFLP in silico. Virtual descriptive methods are used to analyze data and collect information about the object of study. The restriction enzyme HpaII was used in this study. The results showed that there were two alleles (A1 and A2) out of a total of 15 sequences of the E6 HPV 16 gene in Popset 636528409 indicating that there was a genetic variation in the gene.
Co-Authors Afionita, Santi Ahmad Hambali, Ahmad Ahmad Wibisana, Ahmad Alvenaya Hindayageni Ananda Putri, Ananda Annisa Irna Putri Annisa Khaira Annisa Khaira Annisa, Silvy Aprilia, Amanda Ara, Farrah Azzahra Ardi Ardi Atifah, Yusni Aura Zahra Nafisah Azizah, Jalilah Bintang Fadhil Ramadhan Cici Mustika cynthia perdana putri Dara Suci Amini, Dara Suci Des M Dezi Handayani Dwi Hilda Putri Dwi Hilda Putri Dwi Hilda Putri Edwin Edwin Elsa Badriyya Elsa Yuniarti Elviana, Alifah Hazelia Fadhila Humaira Fatiha, Fathma Dwi Fevria, Resti Fitri, Afifah Ismu Gilang Amanda Hafizah Fadhilah Hafizh Alza Afra Helsa Rahmatika Herisanti, Dini Irma Leilani Eka Putri Iyan Robiansyah Iyan Robiansyah Jalilah Azizah Jumatul Hafsah Khairani, Fidia Aura Linda Advinda Marten, Threo Wanda Monica , Indiastri P Moralita Chatri Muhammad Farikh Muharani, Silvia Mutia Andini, Tri Nabilah, Rezi Nadira Nafisa Arini Nella Fauziah Nur Aqsha Nurfadillatun Nisa Wijaya Nurul Hasanah NURUL HIDAYAH Oliv Nurul Kanaya Nurul Kanaya Pinta, Sari Rahma Pradila, Andini Novalia Pramila, Cindy Pratama, Chelsylia Dara Pratama, Sandi Fransisco Pryatna, Muhamad Zacky Putri, Isna Aryunita Putri Putri, Santi Diana Putrizalda, Hafizhah Rahmad Wanizal Pastha Rahmawati, Atika Ayu Rezeki Rival Alridho Rezi Nabilah Ria Fernanda, Irma Rijal Satria Rijal Satria Rini Wulandari Rinti Mutiara Sari Riza Umami Ruri Fitriyani Ruri Fitriyani S. Syamsurizal safitri, fira Salsabil, Velina Salsabilla, Vishtari Sari Rahma Pinta Sari, Rinti Mutiara Satria, Rijal Sefina, Nadia Sisca Alicia Farma Suryani, Elisa Vauzia Vauzia Vauzia, Vauzia Velina Salsabil Violita Violita Violita Violita Violita Violita Violita Yulita, Nelfi Yuni Ahda Yuni Ahda Zultsatunni’mah Zultsatunni’mah Zulyusri Zulyusri Zulyusri Zulyusri Zulyusri, Zulyusri Zulzusri, Zulzusri