cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kota bandung,
Jawa barat
INDONESIA
Jurnal Biodjati
Published by Universitas Islam Negeri Sunan Gunung Djati Bandung
ISSN : 25481606     EISSN : 25414208     DOI : 10.15575/biodjati
Core Subject : Science,
Biochemistry, Genetics & Molecular Biology Earth & Planetary Sciences
Arjuna Subject : -
Articles 15 Documents
 1   2 
Search results for , issue "Vol 6 No 2 (2021): November" : 15 Documents clear
Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes Resmi, Denia Dwi Citra; Hidayat, Topik; Sriyati, Siti
Jurnal Biodjati Vol 6 No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13991

Abstract

Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.
Nocturnal Coleoptera and Hemiptera Diversity at Giam Siak Kecil Bukit Batu Biosphere Reserve Indonesia Ruslan, Hasni; Tobing, Imran S. L.
Jurnal Biodjati Vol 6 No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.14102

Abstract

Giam Siak Kecil Bukit Batu is a biosphere reserve which one of its functions is as a habitat for wildlife. However, biodiversity data in the Giam Siak Kecil Bukit Batu Biosphere Reserve (GSKBB-BR) is still very minimal, including insects (Coleoptera and Hemiptera). This research was conducted to determine the diversity of Coleoptera and Hemiptera in the GSKBB Biosphere Reserve, Riau, Indonesia. The research was carried out using an exploratory method using "lights trap". The results of the study found 30 species, from 11 families of the order Coleoptera (23 species) and Hemiptera (7 species) in the GSKBB-BR. The diversity index of Coleoptera and Hemiptera at the observation site was moderate (H = 2.73), with a high evenness index (0.80). Scarabaeidae (order Coleoptera) is the family with the highest number of species found (8 species), while the most abundant species were Tibicen linnei and Pomponia fusca (Cicadidae/Hemiptera). Based on their functional roles, Coleoptera and Hemiptera with the highest number are herbivores (17 species), followed by predators (7 species) and decomposers (3 species). The range of values for temperature and humidity at the research site are in normal conditions. The GSKBB-BR area is an important remaining habitat for wildlife in Riau, including various types of insects (Coleoptera and Hemiptera); whose potential still needs to be revealed, and must be managed properly.
Habitat Preference Modeling of Prehistoric Giant Shark Megalodon During Miocene in Bentang Formation of West Java Coast Andriwibowo, Andriwibowo; Basukriadi, Adi; Nurdin, Erwin; Mubarok, Muh Aydava
Jurnal Biodjati Vol 6 No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.14115

Abstract

In the Miocene era about 20 million years ago, the South Coast of West Java was a sea and habitat for marine organisms including giant sharks Megalodon measuring about 18 meters long. This study aimed to model the habitat preference of the prehistoric gigantic shark Otodus megalodon population based on the fossil record. From fossil teeth, it revealed that the rock layer where the teeth found was Bentang formation from Miocene era. Many fossils of Megalodon had been unearthed from Bentang formation which is part of the South Coast of West Java. The habitat model was developed using the Sea Level Rise Inundation Tool of ArcGIS to estimate the sea depth and Megalodon’s habitat during the Miocene. The length of the teeth of O. megalodon found was ranged from 13 to 19 cm, indicating the presence of juvenile and adult O. megalodon. Based on the model, in the Miocene era, half of West Java was a sea with a depth ranging from 0 to 200 meters. At that time, it was estimated that juvenile O. megalodon occupied waters with a depth of 0-40 meters with an area of 1365 km2. Meanwhile, adult O. megalodon prefers a depth of 80-160 m and the frequency of habitat use increases at a depth of 200 m. The declining population of O. megalodon is associated with climate change and declining prey populations.
Genetic Profiling of Sida rhombifolia Originated from Several Indonesian Ethnicities Based on Sequence-Related Amplified Polymorphism Markers Solihah, Jumailatus; Kurniatanty, Isma; Subositi, Dyah; Maruzy, Anshary; Martiwi, Ika Nugraheny Ari; Ainy, Erny Qurrotul; Anam, Khoirul; Dina, Aslikh Lana
Jurnal Biodjati Vol 6 No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.14553

Abstract

Sida rhombifolia is one of wild flowering plants that grows easily in many habitats with moderate humidity, with some usefulness in traditional medicine. Genetic characterization of Sida rhombifolia accessions originated from 12 ethnicities of Indonesia was analyzed based on Sequence-Related Amplified Polymorphism (SRAP) Markers. The genomic DNA were extracted from leaf samples and then were characterized by using the SRAP marker system according to Li and Quiros (2001). Nine pairs of SRAP primer resulted high polymorphic bands and were used in the genetic profiling. The data analysis was performed using GenAlEx to calculate genetic distance, Principal coordinate analysis, and Analysis of Molecular Variance (AMOVA), also using POPGENE to assess genetic diversity (Hs and Ht) and Nm to predict gene flow among populations. The coordinate analysis showed that the accessions originated from ethnicities along Wallacean line tend to differ genetically from most other locations. However, the results of analysis of molecular variance suggested that there were only slight differences (0.1%) found between ethnicities, while most genetic variances (99.9%) were found mostly among accessions within populations. The results suggested that there was an extensive genetic flow and plant spreading among Sida rhombifolia plant populations, resulting more homogenous genetic characters among most populations, while high diversity within population. The calculation of the number of migration (Nm = 1.7341) confirmed that the high rate of gene flow had occurred between populations.
Bioconversion of Fermented Barley Waste by Black Soldier Fly Hermetia illucens L. (Diptera; Stratiomyidae) Permana, Agus Dana; Rohmatillah1, Din Dzakamala Fafi; Putra, Ramadhani Eka; Julita, Ucu; Susanto, Agus
Jurnal Biodjati Vol 6 No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.14609

Abstract

Black Soldier Fly Larvae (BSFL), Hermetia illucens (Diptera: Stratiomyidae) are widely used as bioconverter agents for various organics waste, and BSF pupae are often used as fodder for poultry and fish, because the BSF pupae have a high protein content. This study focused on applying BSFL as a bioconversion agent of the fermented barley waste to convert it to larvae biomass. Prior to application, barley waste was fermented either using effective microorganisms-4 (EM4), leachate, and water for seven days. The fermented barley waste was applied as feeding material for BSFL at the rate of 100 mg/larvae/days. As control commercial chicken fed (CF) was applied as feeding material at a similar feeding rate. During this study, waste reduction index (WRI), and efficiency of digested feed (ECD) were calculated, and the protein content in the BSF prepupae was analyzed. The results of this study showed that BSFL fed with CF produces the shortest development time (27 days), and high consumption rate. BSFL fed with barley waste fermented with EM4 (BE) and Leachate (BL) produces a larval period of 31 and 30 days respectively, and statistically those were not significantly different from control. This study showed that treatments of BE and BL, produced a very high larval survival rates, 98.67% and 97.00% respectively, and those two treatments were not statistically different from the control (96.67%). Although the control treatment resulted in a higher WRI compared to the other treatments, but the ECD of BE and BL treatments were higher than the ECD of the control. From this study, it can be concluded that BSFL has a good ability to convert fermented barley waste as well as controls, and the prepupae has a high protein content (42%), so BSFL fed with fermented barley waste has the opportunity to be used as a fed for poultry and fish.

Page 2 of 2 | Total Record : 15

 1   2 

Filter by Year

2021 2021


Reset
Filter By Issues
All Issue Vol 10 No 2 (2025): November Vol 10 No 1 (2025): May Vol 9, No 2 (2024): November Vol 9 No 2 (2024): November Vol 9 No 1 (2024): May Vol 9, No 1 (2024): May Vol 8, No 2 (2023): November Vol 8 No 2 (2023): November Vol 8 No 1 (2023): May Vol 8, No 1 (2023): May Vol 7 No 2 (2022): November Vol 7, No 2 (2022): November Vol 7, No 1 (2022): May Vol 7 No 1 (2022): May Vol 6 No 2 (2021): November Vol 6, No 2 (2021): November Vol 6 No 1 (2021): May Vol 6, No 1 (2021): May Vol 5, No 2 (2020): November Vol 5 No 2 (2020): November Vol 5 No 1 (2020): May Vol 5, No 1 (2020): May Vol 4, No 2 (2019): November Vol 4 No 2 (2019): November Vol 4, No 1 (2019): May Vol 4 No 1 (2019): May Vol 3 No 2 (2018): November Vol 3, No 2 (2018): November Vol 3, No 1 (2018): May Vol 3 No 1 (2018): May Vol 2 No 1 (2017): Jurnal Biodjati, Vol II, Nomor 1, Mei 2017 Vol 2 No 2 (2017): November Vol 2, No 2 (2017): November Vol 2, No 1 (2017): May Vol 1 No 1 (2016): Jurnal Biodjati, Volume I, Nomor 1, November 2016 Vol 1, No 1 (2016): November More Issue