cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
Syamsurizal
Contact Email
syam_unp@fmipa.unp.ac.id
Phone
-
Journal Mail Official
syam_unp@fmipa.unp.ac.id
Editorial Address
-
Location
Kota padang,
Sumatera barat
INDONESIA
Bioscience
Published by Universitas Negeri Padang
ISSN : 2614669X     EISSN : 2579308X     DOI : -
Core Subject : Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Immunology & microbiology
Bioscience ISSN 2579-308X (Electronic) ISSN: 2614-669X (Print) is peer-reviewed journal and scientific journal publish by Universitas Negeri Padang. The aim of this journal is to publish articles dedicated to all aspects of the latest outstanding developments in the field of biology. Scope of this journal is ;Environmental Biology; Genetics and Biotechnology; Biology of Function; Systematics, Structure and Development.
Arjuna Subject : -
Articles 6 Documents
 1 
Search results for , issue "Vol 7, No 2 (2023): Biology" : 6 Documents clear
Specific primer design and optimization of annealing temperature for amplification gene peroxidase (POD) in Oryza sativa L. Nella Fauziah; Afifatul Achyar; Zulyusri Zulyusri; Yusni Atifah; Linda Advinda; Violita Violita
Bioscience Vol 7, No 2 (2023): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v7i2.122972

Abstract

Peroksidase (POD) merupakan enzim antioksidan yang memiliki beragam fungsi dalam siklus hidup tanaman, salah satunya adalah sebagai pertahanan dalam melawan ROS dengan mengkatalisis konversi H2O2 menjadi udara dan O2 . Kemampuan aktifitas enzim POD dalam mengatur kandungan H2O2 memungkinkan enzim tersebut dapat mempertahankan tanaman dari cekaman. Metode yang dapat digunakan untuk amplifikasi gen POD salah satunya yaitu kuantitatif reverse transcription- PCR (qRT-PCR). Metode ini memerlukan beberapa komponen penting salah satunya yaitu primer ( forward dan reverse ). Primer yang digunakan dalam amplifikasi gen harus spesifik terhadap gen target sehingga dapat mengenali dan menempel pada gen target yang diinginkan. Penelitian ini bertujuan untuk mendesain primer yang sesuai untuk amplifikasi gen POD menggunakan teknik qRT-PCR. Primer dirancang menggunakan perangkat PrimerQuest. Primer yang telah dirancang kemudian dianalisis untuk spesifikasinya dengan geneious prime . Kemudian spesifikasi primer di cek menggugakan primer BLAST. Hasil desain primer dengan kriteria terbaik untuk amplifikasi gen POD yaitu Forward POD 5'-AAATGCGTCGATCTACTGTACCT-3' dan Reverse POD 5'-GTGTTGAAAATGGCAATAAACCGG-3'
Rice Growth Response to Drought Simulation Treatment Using PEG Annisa Khaira; Zulyusri Zulyusri; Afifatul Achyar; Dwi Hilda Putri; Yusni Atifah; Violita Violita
Bioscience Vol 7, No 2 (2023): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v7i2.122674

Abstract

Rice is the main food source for Indonesians. The demand for rice to meet people's needs increases every year due to population growth and efforts to improve nutrition by the community. One of the problems that can affect rice production is drought. Drought is an environmental condition when plants do not get enough water to grow and develop optimally, which can cause a decrease in rice production. To find out how rice growth responds to drought, a study was carried out by giving drought simulation treatments using polyethylene glycol (PEG) on several rice varieties. This study used a completely randomized design that was arranged in a factorial manner with two factors. The first factor was the rice varieties (Harum, Situbagendit, Rosna) the second factor was 0% and 20% PEG concentration. The data obtained were then analyzed statistically using a two-way ANOVA test, and if the results were significantly different, then proceed with Duncan's test at the 5% level.The results showed that the drought simulation treatment had a negative effect on rice growth. Drought simulation treatment using 20% PEG resulted in a decrease in Kadar air relatif (KAR), root length, plant height, and root dry weight of rice. The highest decrease in KAR was found in the sensitive rice variety (Rosna), which was 43.42%. The highest average root length (7.99 cm) was on the sitabaendit variety, and the lowest (5.61) was on the rosna variety. The highest average crown height (17.32 cm) and the lowest (6.61) were on the rosna variety.
Multiple Alignment and Primer Design for Groups of Barnacle Organisms and Amphibalanus amphitrite as Biofouling Markers Muhammad Farikh; Rahmad Wanizal Pastha; Rezeki Rival Alridho; Aura Zahra Nafisah; Bintang Fadhil Ramadhan; Afifatul Achyar
Bioscience Vol 7, No 2 (2023): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v7i2.125392

Abstract

Biota pengotor atau biofouling adalah organisme hidup yang menempel pada suatu substrat. Dampak yang ditimbulkan oleh aktivitas biofouling biota adalah oleh karena sifatnya yang korosif sehingga dapat menyebabkan kelumpuhan pada bangunan instalasi. Untuk memfasilitasi instalasi dan kestabilan biodiversitas, peneliti mencoba menghadirkan environmental DNA (e-DNA) sebagai sampel lingkungan tanpa membunuh dan mengisolasi suatu organisme tersebut dengan memanfaatkan sampel lingkungan. Penelitian ini bertujuan untuk memperoleh primer universal dan spesifik dari COX1 yang dapat digunakan untuk mengidentifikasi biofouling kelompok Barnacle yang dirancang secara in silico. Sekuen organisme target yang digunakan dalam penelitian ini adalah DNA mitokondria dari Amphibalanus amphitrite, Amphibalanus reticulatus dan Semibalanus balanoides dengan nomor aksesi NC_024525, NC_071896 dan NC_039849.. Sekuen gen COX1 yang diperoleh disimpan dalam format FASTA untuk digunakan lebih lanjut di dalam proses desain primer menggunakan Geneious Prime. Penentuan daerah lestari ditentukan dengan Geneious Prime dalam tahapan multiple alignment. Sekuen dengan kriteria primer spesifik terbaik untuk COX1 A.amphitrite didapatkan dengan panjang 20-22 basa dan ukuran amplikon 910 bp. Urutan basa primer foward dan reverse adalah 5'-GAGCTGAACTTGGTCAACCG-3' dan 5'-GCTCAAAGAAGAGGAGGGCTAT-3'. Sekuen dengan kriteria primer universal kelompok barnacle terbaik untuk COX1 didapatkan dengan panjang masing-masing 24 basa dan ukuran amplikon 1.270 bp. Urutan basa primer foward dan reverse adalah 5'-GACTTCTACCGTTAATGTTAGGAG-3''dan 5'-CTATGGTAATGAGGAGGAGTAGTG-3'. Hasil desain memenuhi syarat kriteria primer yang baik sehingga kandidat primer hasil desain dapat digunakan untuk proses PCR.
Antioxidant Activity, Total Phenolic and Flavonoid Content of Honey Bee Narti Fitriana; Risya Raisyah; Siti Nurbayti; Festy Auliaur Rahmah
Bioscience Vol 7, No 2 (2023): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v7i2.125200

Abstract

Honey is a natural product that has many benefits,for living organism. The composition of honey is very diverse and depends on the type of honey and the region of origin. Bioactive compounds in honey including phenolics and flavonoids cause honey to having antioxidant activity. This study aims to identify honey bees, determine the chemical properties of honey based on the parameters of water content, acidity, and reducing sugar, and analyze the antioxidant activity and phenolic and flavonoid content of honey from Bukit Tiga Puluh National Park Riau and Prabumulih South Sumatra. The research using descriptive method were morphological identification of bees, testing parameters of honey bee chemical properties, DPPH antioxidant test to obtain IC50 (Inhibition consenteration) values, total phenolic and flavonoid levels. The identified bees are Apis mellifera (from Riau) and A. dorsata (from Prabumulih). This essay showed that the determination of water content, acidity, reducing sugar, both honeys fulfill SNI 8664:2018 except the reducing sugar of A. dorsata honey bee. A. dorsata honey bee has antioxidant activity higher IC50 value (590 mg/L) than A. mellifera honey (678 mg/L). Total phenolic (TPC) and flavonoid (TFC) of A. mellifera honey were 7.51 mg GAE/g and 0.06 mg QE/g, respectively higher than A. dorsata honey bee (3.35 mg GAE/g and 0.42 mg QE/g).
Design and Specificity Test of Specific Primers for Neuroglobin Gene Expression Modulation in Brain Tissue of Rattus norvegicus using qRT-PCR Bintang Fadhil Ramadhan; Muhammad Farikh; Muhammad Naufal Arrafi; Nagra Aulia Valofi; Walidatul Awaliyah; Jessi Rizkanauli Simangungsong; Dini Herisanti; Siska Alicia Farma
Bioscience Vol 7, No 2 (2023): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v7i2.125246

Abstract

Neuroglobin (Ngb) is a newly discovered globin that is found in large numbers in neurons. Brain cells are very sensitive to lack of oxygen and can begin to die within five minutes after the oxygen supply is cut off. hypoxic conditions of brain tissue are ischemic in the area of the bleeding center. This study aims to design and analyze the expression of the Neuroglobin Rattus norvegicus mRNA gene in silico as a nucleotide that is able to read neuroglobin gene expression due to hypoxic states. The neuroglobin gene sequence was obtained using a "nucleotide" search menu provided by NCBI GenBank and designed using Geneious Prime bioinformatics software. The neuroglobin gene sequence used in this study was Rattus norvegicus mRNA with accession number NM_033359.3|:1-1,773. Synthesized primary pairs are optimized using PCR gradients. PCR products were analyzed by electrophoresis using 1.5% agarose gel, 100 V for 27 minutesThe results obtained one forward primer for Rattus norvegicus neuroglobin (Ngb) which has a length of 20 bases with the order of 5' AGTCTTAGCCTCTCCCCCAG -3' and reverse primer has a length of 20 bases with the order of 5' GTCTACAGAACCACGGCACAcx-3' product size 803 bp. The difference Tm in this pair of primers is 0.9 0C. The gradient PCR results showed the thickest and clearest DNA bands were at 57.7°C.  Primers with the best primary criteria for neuroglobin genes were obtained with an amplicon size of 803 bp and an aneealing temperature of 57.7 °C.  The design results meet the requirements of good criteria so that the primary candidate design results can be used for the PCR process.
The Potential of Hot Water Sapan Sungai Aro Thermophilic Bacteria Consortium in Producing Bioethanol Inayatul Fatia; Irdawati Irdawati; Linda Advinda; Azwir Anhar
Bioscience Vol 7, No 2 (2023): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v7i2.123265

Abstract

Biofuel is a potentially renewable alternative fuel in Indonesia. Bioethanol is one example of the most commonly used biofuel. Microorganisms of thermophilic bacteria are known to contribute to the production of bioethanol. Thermophilic bacteria are efficient against high temperature conditions so as to minimize contamination. Production of bioethanol can also use joint culture (consortium). Bioethanol production using a microbial biculture consortium is known to significantly increase the level of bioethanol production. The purpose of this study was to determine the compatibility and to determine the optimum potential of the thermophilic bacterial biculture consortium of Sapan Sungai Aro hot water for bioethanol production. This research is a type of descriptive research. To test the cooperation between consortium isolates of thermophilic bacteria producing bioethanol, a compatibility test was carried out using the disk diffusion method. Then the consortium isolates were fermented in liquid TMM (Thermophilic Minimum Media) medium, the bioethanol content was measured after distillation using a pycnometer. The results of the bacterial compatibility test showed that there was one pair of isolates that were not compatible, namely SSA 8 & SSA 14 due to the presence of a clear zone. On research results. The production of bioethanol by a consortium of thermophilic bacteria gives more optimal results compared to a single isolate. The best thermophilic bacterial biculture consortium from the Sapan Sungai Aro hot spring in producing biofuels is SSA 14 & SSA 16 which is 3.009%. 

Page 1 of 1 | Total Record : 6

 1 

Filter by Year

2023 2023


Reset
Filter By Issues
All Issue Vol 8, No 2 (2024): Biology Vol 8, No 1 (2024): Biology Vol 7, No 2 (2023): Biology Vol 7, No 1 (2023): Biology Vol 6, No 2 (2022): Biology Vol 6, No 1 (2022): Biology Vol 5, No 2 (2021): Biology Vol 5, No 1 (2021): Biology Vol 4, No 2 (2020): Biology Vol 4, No 1 (2020): Biology Vol 3, No 2 (2019): Biology Vol 3, No 1 (2019): Biology Vol 2, No 2 (2018): Biology Vol 2, No 1 (2018): Biology Vol 1, No 2 (2017): Biology Vol 1, No 1 (2017): Biology More Issue