Garuda - Garba Rujukan Digital

Article Per Year (5 Year)

All

Natural B

NATURAL B
Website

Published by Universitas Brawijaya

ISSN : - EISSN : - DOI : -

Core Subject : Social,

Environmental Science

Anda dapat mengakses artikel-artikel hasil penelitian khususnya bidang lingkungan dan kesehatan. Untuk informasi lebih lanjut, silakan menghubungi redaksi jurnal.

Arjuna Subject : -

Articles 15 Documents

1 2

Search results for , issue "Vol 1, No 3 (2012)" : 15 Documents clear

Insecticide Effects on Membrane Potential of Catfish Egg Cell (Clarias batrachus) Unggul Punjung Juswono; Kusharto Kusharto; Yeni Cahyati; Risalatul Latifah
Natural B, Journal of Health and Environmental Sciences Vol 1, No 3 (2012)
Publisher : Natural B, Journal of Health and Environmental Sciences

Pollution has been occured in our environment due to daily life waste, industrial and using of peptiside in agroindustrial farm. Over usuage and dose of peptiside could be harmfull to the farm environment especially for fish farm. Measurement of membrane potential of fish egg cells is a simple metode to investigate water polution level. Membrane potential of fish egg cells can be measured using microelectrode probe which is connected to an electrometer. The changing of membrane potential value indicate the level of water polution. Variation of peptiside concentrations cause the changing of potential membrane value. Increasing of peptiside concentration cause decreasing of potential membrane. Its may due to some blocking of channel and other protein by peptiside molecule so the permeability of membrane to ions is decrease. The results of our experiment show that the increasing of peptiside concentration cause decreasing of the membrane potential value. For peptiside concentration of 0.4% decrease potential membrane to -28 ± 5 mV. It means that the increasing peptiside concentration cause significanly decrease in potential membrane which may be used for prediction of water polution level.

Early Poly Mass Effect (trimethylene-sebasat) On Biodegradation Rate In Liquid Media Using Mucor Miehei In Aerobic Kholisul Fuad, Akhmad; Mardiana, Diah; Roosdiana, Anna
Natural B, Journal of Health and Environmental Sciences Vol 1, No 3 (2012)
Publisher : Natural B, Journal of Health and Environmental Sciences

The author has conducted research about the effect of poly(trimethylene-sebacate) mass toward the rate of biodegradation using Mucor miehei in aerobic liquid media. Poly(trimethylene-sebacate) is a biodegradable linear aliphatic polyester, that can be degraded by Mucor miehei lipase. To determine the effect of poly(trimethylene-sebacate) mass in the biodegradation, the mass of poly(trimethylene-sebacate) were varied 0.06 g, 0.08 g, 0.1 g, 0.12 g and 0.14 g. Biodegradation process carried out for 12 hours, using liquid of Complex media, which was nutrient rich for Mucor miehei growth, and solution at pH 5. The resulting CO2 gas was flowed into the 50 mL reservoir of 0.1 M NaOH, followed by titration using 0.05 M HCl and MO (methyl orange) and PP (phenolptalein) indicator. The rate of CO2 gas were 0.287 x 10-3 M/h; 0.102 x 10-3 M/h; 0.137 x 10-3 M/h; 0.016 x 10-3 M/h; and 0.039 x 10-3 M/h respectively. The greater rate of CO2 produced the lower mass of poly(trimethylene-sebacate).

Landslide Zone Investigation with Resistivity Method In Jombok Village, Ngantang District, Malang Regency Pitoyo Widhi Atmoko; Adi Susilo; Arief Rahmansyah
Natural B, Journal of Health and Environmental Sciences Vol 1, No 3 (2012)
Publisher : Natural B, Journal of Health and Environmental Sciences

Has done research in the Jombok Village, it’s village isone of the areas prone to landslide, this can be seen the existence of land subsidence that has occurred more than once in the same place and of the circumstances surrounding the research that was once a forest area, now used as farmland by human residents. One method used in this research is using geoelectric resistivity method. The data has obtained from geoelectric results, in the entire area has a type of clay and sand, whereas in areas that are kind of soil is a decline in soil, addition of these data, hazardous Jombok Village, Hamlet Songkorejo demonstrated the value of score susceptibility of 3.85, where the value is included in the category of susceptible/prone.

Amplification Pattern of Partial Gene BMP-15 and GDF-9 in Bali Cattle Sri Rahayu; M. Sasmito Djati; Agatha Maria Dian Kusumawati; Oktavia Fitri Santika
Natural B, Journal of Health and Environmental Sciences Vol 1, No 3 (2012)
Publisher : Natural B, Journal of Health and Environmental Sciences

The aim of this research was to determine the polymorphisms of BMP-15 and GDF-9 gene of Bali cattle. DNA was isolated from blood samples of six female cattles with salting out method. Quantitative and qualitative analysis of DNA was measured using spectrophotometer and agarose gel electrophoresis. To get DNA fragment BMP-15 gene was amplified using Forward (5’- AGTTTGTACTGAGCCGGTCT -3'), Reverse (5’- CTGACACACGAA GCGGAGT -3’), while to get DNA fragmen GDF-9 gene was amplified using Forward primer (5’-CAAGGAGGGGACCCCTAAAT-3’), reverse primer (5’- ACCAGAGGCTCAAGAGGAGC- -3’) for GDF-9. The results of amplification showed 4 haplotypes for BMP-15 and GDF-9 gene. It was concluded that there is polymorphism of BMP-15 and GDF-9 gene of Bali cattle.

Geomagnetic Survey In Cangar Area, Batu City, East Java To Assess the Potential of Geothermal Akhmad Afandi; Sukir Maryanto; Adi Susilo
Natural B, Journal of Health and Environmental Sciences Vol 1, No 3 (2012)
Publisher : Natural B, Journal of Health and Environmental Sciences

The prospect ofgeothermal field of Cangar’s in Batu, East Java has been observed based on the geomagneticmethod using aProtonPrecisionMagnetometer (PPM-856).The purpose is to know the magnetic anomalies around the geothermal area. The resultsshown that the residual anomaly distributed in the range of -1.000 nT to 680 nT and the low anomaly(negative) at about -1.000nTlocatedonthe northand westof themanifestations ofhotwater. Geothermalpotential based on the subsurfacemodeling of the structures on the line A-B at position 49 M 0669,071.13174 mT UTM 9,144,184.60107 mU has a value of susceptibilitycontrast of -3.166with a volume of ± 1,550,345m3. Furthermore, on the line C-D at position 49 M 0669,168.601085 mT UTM 9,143,915.10292 mU shown a value of susceptibilitycontrast at -0.018with thevolume of ± 16,610m3.

Page 2 of 2 | Total Record : 15

1 2

Filter by Year

2012 2012

Filter By Issues

All Issue Vol 5, No 2 (2019) Vol 5, No 1 (2019) Vol 4, No 4 (2018) Vol 4, No 3 (2018) Vol 4, No 2 (2017) Vol 4, No 1 (2017) Vol 4, No 1 (2017) Vol 3, No 4 (2016) Vol 3, No 3 (2016) Vol 3, No 2 (2015) Vol 3, No 1 (2015) Vol 2, No 4 (2014) Vol 2, No 3 (2014) Vol 2, No 2 (2013) Vol 2, No 1 (2013) Vol 2, No 1 (2013) Vol 1, No 4 (2012) Vol 1, No 3 (2012) Vol 1, No 2 (2011) Vol 1, No 1 (2011) Vol 1, No 1 (2011) More Issue

Home Page

OAI Link

Editorial Team

Contact

Reviewer

Google Scholar

Contact Name
-

Contact Email
-

Phone
-

Journal Mail Official
-

Editorial Address
-

Location
Kota malang,

Jawa timur

INDONESIA

Abstract

Abstract

Abstract

Abstract

Abstract

Home Page

OAI Link

Editorial Team

Contact

Reviewer

Google Scholar

Contact Name -

Contact Email -

Phone -

Journal Mail Official -

Editorial Address -

Location Kota malang, Jawa timur INDONESIA

Abstract

Abstract

Abstract

Abstract

Abstract

Contact Name
-

Contact Email
-

Phone
-

Journal Mail Official
-

Editorial Address
-

Location
Kota malang,

Jawa timur

INDONESIA