Article Per Year (5 Year)
p-Index From 2021 - 2026
0
P-Index
This Author published in this journals
All Journal Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati
Zein, M. Syamsul
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology

Published : 1 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 1 Documents
Search

 1 
Keragaman Daerah Kontrol DNA Mitokondria Rusa Timor (Cervus timorensis timorensis) di Pulau Timor, Alor, dan Pantar Zein, M. Syamsul
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 3 (2007): October 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v12i3.2799

Abstract

A study on mtDNA control region diversity of the timor deer was conducted in EastNusa Tenggara Province. Sample consisted of 20 individuals from 3 islands (Timor,Pantar, and Alor). Total DNA were extracted from leucocyte (buffy coat). Fragmentcontrol region of the mitochondrial DNA were amplified by Polymerase ChainReaction (PCR) using primers of forward primer5”AAACCAGAAAAGGAGAGCAAC3” and reverse primer5”TCATCTAGGCATTTTCAGTGCC3”. Nucleotide sequence of the mitochondrialcontrol region were aligned by using ClastalX and phylogenetic analyses by Neighbor-Joining methode. Kimura two-parameter model of nucleotide substitution usingpairwise distance calculation program was implemented with the Mega softwareversion 3. The purposes of this study, were to examine the control region (D-Loop) ofthe mitochondrial DNA and to discuss the phylogeography of the Cervus timorensistimorensis in East Nusa Tenggara Province. Results indicated that from 435 basenucleotide sequences, 16 polymorphic sites with 8 haplotypes were found among 3islands. Haplotype diversity and nucleotide diversity were 0.056 and 0.039. DNAdistances values ranged from 0.014 to 0.021.
Co-Authors