Article Per Year (5 Year)
p-Index From 2021 - 2026
0.444
P-Index
This Author published in this journals
All Journal Jurnal Biodjati BIODIVERS - BIOTROP Scientific Magazine
Resmi, Denia Dwi Citra
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Earth & Planetary Sciences Energy Environmental Science

Published : 2 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 2 Documents
Search

 1 
Effectiveness of DNA Barcoding Primers in Red Algae (Rhodophyta) Identification Khan, Aidil Zaid; Fernando, Ardian Putra; Pamungkas, Edo Agam; Andhira, Ayu; Ishlah, Rifa Nur; Resmi, Denia Dwi Citra; Damayanti, Farida; Rahmawati, Dewi
BIODIVERS - BIOTROP Science Magazine Vol. 4 No. 1 (2025): Vol. 4 No. 1 (2025): BIODIVERS Volume 4 No. 1 (2025)
Publisher : SEAMEO BIOTROP

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Red algae (Rhodophyta) are vital primary producers in marine ecosystems and are economically significant due to their wide use in food, pharmaceutical, and cosmetic industries. The significant utilization of red algae indicates that these organisms require conservation and protection from extinction, therefore, accurate identification is a must. Traditional morphological approaches face challenges due to their simplicity and plasticity; however, molecular techniques, such as DNA barcoding can overcome these limitations. This study evaluated the effectiveness of using ITS1, Cox2-3, rbcL 1, and rbcL 2 primers for barcoding seven red algae species, focusing on amplification success and sequencing quality. All of the above-mentioned primers have demonstrated a noteworthy amplification rate of success, with 100% efficacy observed for ITS1 and rbcL 2. However, only Cox2-3, rbcL 1, and rbcL 2 primers exhibited a high-quality read based on the sequencing quality score, indicating their reliability in capturing the target sequence for identification. The results strongly suggested that rbcL 2 is the optimal choice for identifying Rhodophyta due to its high amplification rate and high-quality sequencing results.
Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes Resmi, Denia Dwi Citra; Hidayat, Topik; Sriyati, Siti
Jurnal Biodjati Vol 6 No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13991

Abstract

Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.
Co-Authors Andhira, Ayu DEWI RAHMAWATI Farida Damayanti Fernando, Ardian Putra Ishlah, Rifa Nur Khan, Aidil Zaid Pamungkas, Edo Agam Siti Sriyati Topik Hidayat