Article Per Year (5 Year)
p-Index From 2020 - 2025
0.61
P-Index
This Author published in this journals
All Journal Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan
S. Nurjanah
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Veterinary

Published : 3 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 3 Documents
Search

 1 
Contamination of Salmonella spp. on Chicken Carcasses and their Risk Contributing Factors during Supply Chain in Jakarta S. Shalihah; S. Nurjanah; Z. Wulandari
Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 12 No. 3 (2024): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan
Publisher : Department of Animal Production and Technology, Faculty of Animal Science, IPB University in associated with Animal Scientist's Society of Indonesia (HILPI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jipthp.12.3.112-120

Abstract

The consumption of chicken meat by consumers in Jakarta is very high, which is in line with the high supply of it. Salmonella spp. is pathogenic bacteria which is frequently found in chicken carcasses and can cause food borne disease. The aims of this study were to determine the prevalence of Salmonella spp contamination on chicken carcasses and critical factors during distribution chain in Jakarta. The study was conducted based on the risk based approach compiled surveillance data, quantitative analysis of Salmonella spp., survey of good handling, constructed risk ranking and analysis sensitivity. Quantitative analysis determined by plate count method with using selective media XLT4 agar as Salmonella presumptive. Risk profile was involved risk-ranking and sensitivity analysis using Monte Carlo simulation of 100,000 iterations from Oracle Crystal Ball®. The highest prevalence of Salmonella in chicken carcasses is showed from traditional markets (41.86%) with amount was 1.09 ± 0.12 log CFU/g; then is followed from TPHU distribution (17.65%) with amount was 1.92± 1.11 log CFU/g. The risk contributing factors were the non-fulfillment of temperature of transportation from TPHU (12.3% contribution) and the unproper equipment’s cleaning method in traditional market (33.2% contribution). These were the most important aspects to be controlled.
Efektivitas Sanitizer Komersial Berbasiskan Asam Perasetat terhadap Biofilm Bacillus cereus N. Eliza; R. Dewanti-Hariyadi; S. Nurjanah
Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 10 No. 1 (2022): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan
Publisher : Department of Animal Production and Technology, Faculty of Animal Science, IPB University in associated with Animal Scientist's Society of Indonesia (HILPI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jipthp.10.1.8-14

Abstract

Bacillus cereus is known to have the ability to adhere and form biofilms on the surface of stainless steel that causes problems in the food industries. Bacterial biofilms generally can increase resistance to sanitizer treatment. This study aimed to evaluate the ability of peracetic acid-based commercial sanitizer to inactivate B. cereus biofilm on stainless steel (SS) surfaces. Biofilm of B. cereus ATCC 10876 was developed on SS surfaces and treated with 7 commercial peracetic acid-based sanitizers at their recommended dosages. Two sanitizers, i.e. B (peracetic acid and QAC) and F (peracetic acid and acidified water) showing the ability to inactivate B. cereus on solid media at concentration of 200, 400, and 800 ppm were further tested on biofilms with contact times of 1, 3, and 5 minutes. The 48 hours biofilms B. cereus contained 2.78-3.78 CFU/cm2. Both sanitizers B and F had significant effects in inactivating B. cereus biofilm. In general, sanitizer B could reduce more biofilm bacteria at any contact time than sanitizer F. Use of 200 ppm of sanitizer B or F 5 minutes could inactivate 3.04 log CFU/cm2 and 2.68 log CFU/cm2 biofilm, respectively. Exposure of B. cereus biofilm to peracetic acid-based sanitizer resulted in the damage of the extracellular matrix of the biofilms. This study showed that commercial sanitizers containing peracetic acid and quaternary ammonium compounds were effective in inactivating B. cereus biofilms.
Desain Primer Gen Virulensi invA untuk Identifikasi dan Sekuensing Salmonella pada Sampel Karkas Ayam R. P. Melati; S. Nurjanah; W. P. Rahayu
Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 10 No. 2 (2022): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan
Publisher : Department of Animal Production and Technology, Faculty of Animal Science, IPB University in associated with Animal Scientist's Society of Indonesia (HILPI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jipthp.10.2.91-97

Abstract

Identification and sequencing of Salmonella require a specific primer as well as a virulence marker. Invasion gene (invA) is a gene found in all types of Salmonella, specific to Salmonella, and has a low mutation rate so that it can be used as a target gene for Salmonella identification. This study aimed to design a primer of invA gene of Salmonella spp. with long amplicons, has broad serovar coverage, and get an optimum PCR condition. Primers were designed and checked its specificity in silico using Primer-BLAST and then selected. Selected primer was evaluated for annealing temperature and primer concentration. Based on the sequential selection, it was obtained a set of invA gene primer with forwarding sequences GCCGGTGAAATTATCGCCAC (started at base 297) and reverses sequences CTCGTAATTCGCCGCCATTG (started at base 1763). Based on Primer-BLAST analysis, the primer gave an amplicon size of 1486 bp, has annealing temperature of 58 °C, capable of detecting at least 110 Salmonella serovars, capable to detect Salmonella contamination in chickens, and unable to detect the presence of Klebsiella sp., Citrobacter sp., Serratia sp., Hafnia sp., and E. coli. This primer can detect Salmonella very well with annealing temperature of 58 oC and primer concentration of 1.2 µM.
Co-Authors N. Eliza R. Dewanti-Hariyadi R. P. Melati S. Shalihah W. P. Rahayu Z. Wulandari