This Author published in this journals
All Journal Natural B
Sri Rahayu
Jurusan Kimia Fakultas MIPA Universitas Brawijaya Jalan Veteran Malang 65145

Published : 1 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 1 Documents
Search
Journal : Natural B

Amplification Pattern of Partial Gene BMP-15 and GDF-9 in Bali Cattle Sri Rahayu; M. Sasmito Djati; Agatha Maria Dian Kusumawati; Oktavia Fitri Santika
Natural B, Journal of Health and Environmental Sciences Vol 1, No 3 (2012)
Publisher : Natural B, Journal of Health and Environmental Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (336.289 KB) | DOI: 10.21776/ub.natural-b.2012.001.03.12

Abstract

The aim of this research was to determine the polymorphisms of BMP-15 and GDF-9 gene of Bali cattle. DNA was isolated from blood samples of six female cattles with salting out method. Quantitative and qualitative analysis of DNA was measured using spectrophotometer and agarose gel electrophoresis. To get DNA fragment BMP-15 gene was amplified using Forward (5’- AGTTTGTACTGAGCCGGTCT -3'), Reverse (5’- CTGACACACGAA GCGGAGT -3’), while to get DNA fragmen GDF-9 gene was amplified using Forward primer (5’-CAAGGAGGGGACCCCTAAAT-3’), reverse primer (5’- ACCAGAGGCTCAAGAGGAGC- -3’) for GDF-9. The results of amplification showed 4 haplotypes for BMP-15 and GDF-9 gene. It was concluded that there is polymorphism of BMP-15 and GDF-9 gene of Bali cattle.