Article Per Year (5 Year)
p-Index From 2020 - 2025
0
P-Index
This Author published in this journals
All Journal Indonesian Journal of Biotechnology
S. Sumartono
Parasitology Department, Faculty of Veterinary Medicine Gadjah Mada University, Jl. Olah RagaKarangmalang Yogyakarta 55281, Indonesia
Biochemistry, Genetics & Molecular Biology Immunology & microbiology Materials Science & Nanotechnology

Published : 1 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 1 Documents
Search

 1 
A Development of Homolog Sequence of Eimeria tenella Partial Genome as a Probe for Molecular Diagnosis of Coccidiosis S. Sumartono
Indonesian Journal of Biotechnology Vol 10, No 1 (2005)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (150.325 KB) | DOI: 10.22146/ijbiotech.7409

Abstract

The goal of the research was to develop a homolog sequence of Eimeria tenella partial genome as a molecular probe for diagnose coccidiosis using dot blot method. A probe of homolog sequence of E.tenella partial genome and a non radioactive label, dig-11-dUTP, were used for this research. Four concentrations of molecular probe labeled with dig-11-dUTP, namely, 158,33 pg/µl, 52,25 pg/µl, 15,83 pg/µl and 5,225 pg/µl were tested to detect 0,6551 µg DNA target. The procedure of labeling and hybridization detection between DNA target with the molecular probe labeled with dig-11-dUTP were carried out with Digh high prime DNA labeling and detection starter Kit I. The conclusion of the research was that 52,25 pg/µl molecular probe or more which its sequence GGCA CAGTATCCTCCTTCAGGGCAGGG CTCGCACTGGTCAAA CGCGG TAC CATT could detect DNA target by dot blot method.
Co-Authors