Article Per Year (5 Year)
p-Index From 2020 - 2025
0
P-Index
This Author published in this journals
All Journal Journal of Fisheries & Marine
Lestari Wilujeng
Program Studi Akuakultur, Fakultas Perikanan dan Kelautan, Universitas Airlangga, Indonesia.
Biochemistry, Genetics & Molecular Biology

Published : 1 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 1 Documents
Search

 1 
Keragaman Gen Cytochrome B pada Sidat (Anguila bicolor) Berdasarkan Restriction Fragment Length Polymorphism (RFLP) [Genetic Diversity Cythochrome B of Sidat (Anguila bicolor) Assesed by Restriction Fragment Length Polymorhisme (RFLP) ] Gunanti Mahasri; Lestari Wilujeng; Mufasirin Mufasirin
Jurnal Ilmiah Perikanan dan Kelautan Vol. 6 No. 2 (2014): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jipk.v6i2.11294

Abstract

Abstract This study aims to analyze the genetic character of Anguilla bicolor based on cytochrome b gene as the basis of information in the study of phylogeny and genetic engineering. The research was conducted from May to September 2013 in the Laboratory of Biotechnology Faculty of Science, University of Brawijaya. This study uses a survey with qualitative descriptive analysis in the laboratory. Samples obtained from direct arrests in Tulungagung Popo Beach , Manado , Medan and Cilacap. Study was initiated by DNA isolation using CTAB method and followed by PCR . Primers used were cytb - 1 (5' - TGCTAACGATGCCCTAGTGG - 3 ') and b CYT - 2 (5' - CTAGTCAACCTACT - AATGGG - 3 ') . PCR results were cut using restriction enzymes and Msp1 Hha1. Data analysis was performed with the aid of NTSYS software program. Genetic character of a sequence of nucleotide bases making up DNA from the cytochrome b gene were obtained on each sample has a degree of similarity around 32 - 100 %.
Co-Authors Gunanti Mahasri Mufasirin