Journal of Aquaculture and Fish Health
Vol. 15 No. 1 (2026): JAFH Vol. 15 No. 1 February 2026

Specific Primer Design for Characterization and Expression of the Metallothionein (MT) Gene Pilsbryoconcha exilis

Sata Yoshida Srie Rahayu (Department of Biology, Faculty of Mathematics and Natural Sciences, Pakuan University, Bogor, West Java 16143, Indonesia)
Alya Fairuz Fikriyyani (Department of Biology, Faculty of Mathematics and Natural Sciences, Pakuan University, Bogor, West Java 16143, Indonesia)
Toto Hadiarto (BRIN, Gedung Genomik, KST. Soekarno, BRIN, Science Center. Jl. Raya Jakarta-Bogor KM46, Bogor, West Java 16911, Indonesia)
Ren Fitriadi (Department of Aquaculture, Faculty of Fisheries and Marine Science, Jenderal Soedirman University, Jl. Dr. Soeparno, Karangwangkal, Purwokerto, Central Java 53122, Indonesia)



Article Info

Publish Date
21 Jan 2026

Abstract

Mussels (Pilsbryoconcha exilis) have a defense mechanism against high heavy metal concentrations in water. This mechanism probably involves the expression of the metallothionein gene. However, information regarding the MT gene in this species is limited. Thus, characterization of the gene is necessary, beginning with the identification of the presence of the MT gene. Specific degenerate primers need to be designed for PCR amplification of the gene. This study aimed to design specific primers for the MT P. exilis gene. The research methods included exploring the MT gene sequence from GenBank NCBI. The primers were designed manually and analyzed with a Multiple Primer Analyzer and confirmed in silico. The results generate several primer pairs. When paired with reverse primer R1: 5'-GCTGCACTTCACCTTGCAATT-3' or R2: 5'- GCTGCACTTCACCTTGCAATT-3', forward primer F2: 5'- ATGGGCGACCCATGTAACTGT -3' has the potential to produce PCR product(s) from locus NC_044124 P. exilis gene PilExi_F mitochondrion, which has a complete genomic sequence of 16168bp under the suggested PCR parameters. This amplicon is likely to be a strong candidate for the MT gene in P. exilis.

Copyrights © 2026






Journal Info

Abbrev

JAFH

Publisher

Subject

Agriculture, Biological Sciences & Forestry

Description

The Journal of Aquaculture And Fish Health (JAFH) has an objective to publish and provide high-quality scientific contributions to the field of fisheries. These contributions came from innovative researches that encourage science and technology development in the field of fisheries and marine ...