cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kab. sleman,
Daerah istimewa yogyakarta
INDONESIA
Indonesian Journal of Biotechnology
Published by Universitas Gadjah Mada
ISSN : 08538654     EISSN : 20892241     DOI : -
Core Subject : Science,
Biochemistry, Genetics & Molecular Biology Immunology & microbiology Materials Science & Nanotechnology
The Indonesian Journal of Biotechnology (IJBiotech) is an open access, peer-reviewed, multidisciplinary journal dedicated to the publication of novel research in all aspects of biotechnology, with particular attention paid to the exploration and development of natural products derived from tropical—and especially Indonesian—biodiversity. IJBiotech is published biannually and accepts original research articles featuring well-designed studies with clearly analyzed and logically interpreted results. A strong preference is given to research that has the potential to make significant contributions to both the field of biotechnology and society in general.
Arjuna Subject : -
Articles 7 Documents
 1 
Search results for , issue "Vol 30, No 1 (2025)" : 7 Documents clear
Low pH resistant lactic acid bacteria from cow rumen waste Ahimsa Kandi Sariri; Kustantinah Kustantinah; Zaenal Bachruddin; Chusnul Hanim
Indonesian Journal of Biotechnology Vol 30, No 1 (2025)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.85251

Abstract

This study aims to obtain a new strain of lactic acid bacteria (LAB) with the ability to survive at low pH, resulting from isolation, selection, and identification from rumen waste. The research included four stages: isolation of bacteria from rumen waste, selection, and identification. The selection procedure involved growth of LAB in a low pH medium. Molecular identification procedure was conducted using the 16S rRNA gene sequence amplification method with universal primers 27F (AGAGTTTGATCCTGGCT CAG) and 1429R (TAGGGTTACCTTGTTACGACTT). The results of the isolation and identification were analyzed descriptively, revealing that five petri dishes (5a, 10a, 10b, 16a, and 18b) contained lactic acid bacteria which produced clear zones. Among these, isolate 18b was the only LAB strain that survived in a pH 3.5 medium. The results of the molecular identification using the 16s rRNA gene showed that isolate 18b belonged to Limosilactobacillus fermentum.
Characterization and antibacterial activity of biosynthesized silver nanoparticles using Stachytarpheta jamaicensis leaf extract as bioreduction Sandy Samsul Bahry; Ari Susilowati; Artini Pangastuti
Indonesian Journal of Biotechnology Vol 30, No 1 (2025)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.88438

Abstract

Their nanometer size, broad spectrum, and antibacterial mechanism give silver nanoparticles (NPAg) the potential to be used to inhibit the growth and spread of methicillin‐resistant Staphylococcus aureus (MSRA) in medical devices. Synthesis of AgNPs from Stachytarpheta jamaicensis leaf extract is considered more environmentally friendly and has low production costs. The objective of this study was to investigate the properties and antibacterial potential of AgNPs by utilizing S. jamaicensis leaf extract at concentrations of 0.5%, 1.0%, and 1.5% in a 1 mM AgNO3 precursor. Nanoparticle characterization was performed on the AgNP supernatant obtained by centrifuging the synthesis solution at 100 rpm for 5 min. Characterization of the NPAg size was confirmed by surface plasmon resonance (SPR) analysis in UV‐Vis spectrophotometer, while the size distribution was measured by a particle size analyzer. Surface morphology was performed using scanning electron microscopy (SEM), and antibacterial activity was evaluated by the disc diffusion method. The results showed that AgNPs had the best nanoparticle characteristics in an extract concentration of 0.5%, the synthesis indicated by SPR at a wavelength of 434 nm and an average size of 80.67 nm. SEM analysis showed the formation of clusters at variations of 1.0% and 1.5%. The antibacterial activity of AgNPs against MRSA was the highest at 0.5%, with an inhibition zone diameter of 0.77 mm. The higher concentration of S. jamaicencis leaf extract increases the risk of cluster formation, which enlarges the AgNPs, while antibacterial activity was reduced.
Green synthesis of hyaluronic acid‐silver nanoparticles using microalgae extracts, with evaluation of antimicrobial activity Nur Imanina Abdullah Thaidi; Muhammad Azmirul Yusuf; Zahir Haizat Muhamad Zamani; Joo Shun Tan; Ahmad Badruddin Ghazali; Rosfarizan Mohamad; Helmi Wasoh; Murni Halim
Indonesian Journal of Biotechnology Vol 30, No 1 (2025)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.93346

Abstract

Silver nanoparticles (AgNPs) exhibit excellent antimicrobial activity but face challenges such as aggregation and reduced effectiveness when used alone. To address these limitations, green synthesis methods utilizing biological agents as reducing agents have been explored to develop AgNP nanocomposites. This study synthesized AgNPs by incorporating hyaluronic acid (HA) with microalgae extracts from Arthrospira platensis, Chlorella vulgaris, and Nannochloropsis sp., resulting in HA‐AgNP nanocomposites. The experimental parameters, including pH, extract concentration, temperature and synthesis time, were optimized for the preparation of the HA‐AgNPs nanocomposites. The best HA‐AgNPs nanocomposites, synthesized by A. platensis (HA‐SP‐AgNPs), exhibited a Z‐average size of 66.98 nm and polydispersity index (PDI) of 0.494, indicating uniformity and stability. FTIR analysis confirmed the presence of functional groups associated with AgNPs, HA and A. platensis, ensuring structural stability. A key finding of the study is that HA‐SP‐AgNPs demonstrated enhanced antimicrobial activity against bacteria such as Staphylococcus aureus, Escherichia coli, and Bacillus subtilis. Notably, the HA‐SP‐AgNPs were particularly effective against S. aureus and E. coli compared to AgNPs alone. The results underscore the critical role of HA in enhancing nanoparticle stability and antibacterial efficacy, positioning HA‐SP‐AgNPs as a promising antimicrobial agent.
Thrombolytic activity and antibacterial activity optimize staphylokinase enzyme production from Staphylococcus aureus Bilal Husam Jasim; Rand Jabbar Sattar; Maryam Dhary Kamel; Entesar Hussein Ali; Majid Sakhi Jabir; Maryam Hussein Saddi; Bassam Shaker Mahmood; Zahraa Abbas Fadhil
Indonesian Journal of Biotechnology Vol 30, No 1 (2025)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.95686

Abstract

Staphylokinase is a virulence factor produced by Staphylococcus aureus that enhances its ability to degrade proteins, contributing to tissue damage and increased bacterial invasiveness. This investigation studied staphylokinase production by S. aureus isolates obtained from wound and burn patients. Optimal conditions for enhancing staphylokinase production in Sato’s component were determined. These conditions included a carbon source (glucose), a nitrogen source (yeast extract), an inoculum size of 1%, an incubation temperature of 37 °C, and a pH of 7. Optimization of the medium components resulted in a significant increase in staphylokinase production (26.4 U/mL), representing a 2.23‐fold rise compared to production in the unoptimized Sato’s component. The crude staphylokinase enzyme exhibited thrombolytic activity against human blood clots, achieving 42% clot lysis. However, the crude enzyme showed no antibacterial activity against the tested bacteria (Streptomyces and Escherichia coli). This study represents the first report of optimized media for enhancing staphylokinase production from S. aureus. The research is significant because it establishes a method for improving the production of highly active staphylokinase from S. aureus, which has potential applications as a thrombolytic agent.
Black seed oil inhibits the migration of triple‐negative breast cancer cells and regulates MMP‐9 expression Ghina Lintangsari; Alma Nuril Aliyah; Gergorius Gena Maran; Adam Hermawan; Edy Meiyanto
Indonesian Journal of Biotechnology Vol 30, No 1 (2025)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.96177

Abstract

Black seed (Nigella sativa L.) is well known for its pharmacological properties, particularly its anticancer activity, with previous studies demonstrating its cytotoxic effects on several cell lines, such as A‐549, DLD‐1, MDA‐MB231, or HCT. This study aims to investigate the effects of black seed oil (BSO) on the migratory activity of 4T1 triple‐negative breast cancer (TNBC) cells, focusing on its bioactive properties. BSO was extracted via hydro‐distillation and analyzed for its phytochemical composition using gas chromatography–mass spectrometry (GC‐MS). The cytotoxicity of BSO and doxorubicin (Dox) was assessed using the MTT assay. The effects of BSO and Dox on cell migration and matrix metalloproteinase‐9 (MMP‐9) expression were evaluated using a scratch wound‐healing assay and gelatin zymography method respectively. Additionally, intracellular reactive oxygen species (ROS) levels were measured using 2’,7’‐dichlorofluorescin diacetate (DCFDA) staining. GC‐MS analysis identified p‐cymene as a major component of BSO, along with various other bioactive compounds. BSO exhibited low toxicity toward 4T1 cells, while its combination with Dox reduced cell viability in a dose‐dependent manner. Furthermore, BSO in combination with Dox inhibited cell migration and suppressed MMP‐9 expressions in 4T1 cells. BSO treatment also led to an increase in ROS levels. In conclusion, BSO exhibits potential anticancer properties by inhibiting cell migration and downregulating MMP‐9 expression, highlighting its possible therapeutic role in TNBC treatment.
Optimized bioethanol production from banana stem waste via simultaneous saccharification and fermentation with Saccharomyces cerevisiae Neil Priharto; Agung Setiawan; Dea Indriani Astuti
Indonesian Journal of Biotechnology Vol 30, No 1 (2025)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.98638

Abstract

Indonesia, one of the world’s largest banana producers, generates significant quantities of banana stem waste, leading to environmental challenges. This study explores the potential of converting this lignocellulosic biomass into bioethanol using a combination of steam pretreatment and simultaneous saccharification and fermentation (SSF) with Saccharomyces cerevisiae. The SSF process integrates enzymatic hydrolysis and fermentation, streamlining bioethanol production. The research applied the Taguchi method with an L9(34) orthogonal array to optimize key parameters, including enzyme concentration, particle size, temperature, and pH. Optimal conditions—5% enzyme concentration (v/v), 60 mesh banana powder, 35 °C and pH 5.00—yielded a maximum ethanol concentration of 9 g/L. Enzyme concentration and particle size were identified as critical factors in enhancing bioethanol yield. This study highlights the potential of banana stem waste as a sustainable resource for bioethanol production, contributing to waste reduction and renewable energy development.
Duku peel ethyl acetate extract as an adjunctive treatment of doxorubicin on triple negative breast cancer 4T1 cells Faaza Aulia Rahman; Aulia Nur Septiani; Desty Restia Rahmawati; Novia Permata Hapsari; Edy Meiyanto; Ratna Asmah Susidarti
Indonesian Journal of Biotechnology Vol 30, No 1 (2025)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.102112

Abstract

Triple‐negative breast cancer (TNBC) faces significant treatment challenges due to its resistance to chemotherapy and high‐rate metastatic occurrence. Adjunctive treatment is a promising approach to improve chemotherapy effectiveness while reducing toxicity on normal cells. Natural compounds of Lansium domesticum (duku) exhibit potential as adjunctive cancer treatments. This study aims to investigate the potential of duku peel extract (DPE) to be developed as an adjunctive agent. The cytotoxic activity of DPE against 4T1 cells was conducted through MTT assay, both in single and combination treatments. The anti‐migratory effect of DPE was examined by scratch wound healing assay. The molecular mechanism of DPE was confirmed using virtual screening via bioinformatics approaches, including protein target prediction and molecular docking. The results show that DPE has cytotoxic activity with an IC50 value of 47 µg/mL against the 4T1 cell line, in a 24‐hour treatment period. Interestingly, DPE not only had a good synergistic effect (mean CI value, i.e. 0.34), but also showed significant inhibition of cell migration with doxorubicin (Dox). Additionally, virtual bioinformatics screening approaches suggest the potential mechanism of DPE compound action by targeting CDC25B and TOP2A. Overall, DPE holds promise as an adjunctive treatment of Dox against 4T1 TNBC cells.

Page 1 of 1 | Total Record : 7

 1 

Filter by Year

2025 2025


Reset
Filter By Issues
All Issue Vol 30, No 3 (2025) Vol 30, No 2 (2025) Vol 30, No 1 (2025) Vol 29, No 4 (2024) Vol 29, No 3 (2024) Vol 29, No 2 (2024) Vol 29, No 1 (2024) Vol 28, No 4 (2023) Vol 28, No 3 (2023) Vol 28, No 2 (2023) Vol 28, No 1 (2023) Vol 27, No 4 (2022) Vol 27, No 3 (2022) Vol 27, No 2 (2022) Vol 27, No 1 (2022) Vol 26, No 4 (2021) Vol 26, No 3 (2021) Vol 26, No 2 (2021) Vol 26, No 1 (2021) Vol 25, No 2 (2020) Vol 25, No 1 (2020) Vol 24, No 2 (2019) Vol 24, No 1 (2019) Vol 23, No 2 (2018) Vol 23, No 1 (2018) Vol 22, No 2 (2017) Vol 22, No 1 (2017) Vol 21, No 2 (2016) Vol 21, No 1 (2016) Vol 20, No 2 (2015) Vol 20, No 1 (2015) Vol 19, No 2 (2014) Vol 19, No 1 (2014) Vol 19, No 1 (2014) Vol 18, No 2 (2013) Vol 18, No 2 (2013) Vol 18, No 1 (2013) Vol 18, No 1 (2013) Vol 17, No 2 (2012) Vol 17, No 2 (2012) Vol 17, No 1 (2012) Vol 17, No 1 (2012) Vol 16, No 2 (2011) Vol 16, No 2 (2011) Vol 16, No 1 (2011) Vol 16, No 1 (2011) Vol 15, No 2 (2010) Vol 15, No 2 (2010) Vol 15, No 1 (2010) Vol 15, No 1 (2010) Vol 14, No 2 (2009) Vol 14, No 2 (2009) Vol 14, No 1 (2009) Vol 14, No 1 (2009) Vol 13, No 2 (2008) Vol 13, No 2 (2008) Vol 13, No 1 (2008) Vol 13, No 1 (2008) Vol 12, No 2 (2007) Vol 12, No 2 (2007) Vol 12, No 1 (2007) Vol 12, No 1 (2007) Vol 11, No 2 (2006) Vol 11, No 2 (2006) Vol 11, No 1 (2006) Vol 11, No 1 (2006) Vol 10, No 2 (2005) Vol 10, No 2 (2005) Vol 10, No 1 (2005) Vol 10, No 1 (2005) More Issue