Asmarani Kusumawati
Department of Reproduction and Obstetrics, Faculty of Veterinary Medicine, Universitas Gadjah Mada

Published : 2 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 2 Documents
Search

Serotype Specific Sequence for Multi Test Line Nucleic Acid Lateral Flow Development Narendra Yoga Hendarta; Asmarani Kusumawati; Tri Wibawa; Abu Tholib Aman
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.44696

Abstract

Dengue virus that causes dengue fever and dengue shock syndrome has 4 different serotypes. Serotyping is needed for diagnosing and surveillance activities of disease spreaders. Recently, the Nucleic Acid Lateral Flow (NALF) method has been developed to confirm the results of easy amplification without complicated equipment. The aim of this study was designing capture probe for serotyping dengue virus (DENV) using NALF method. We have conducted an analytical study to obtain four specific sequences of Dengue Virus serotypes to develop serotipe specific NALF. Several parameters were used to analyzed Dengue genome sequences i.e % GC content, target homology, length of 100% homology continue of non-specific bases, hybridization temperature, and secondary structure to estimate the probe's capture capability in the hybridization reaction. The capture probes were applied to NALF and assayed using single strand DNA sample to check its performance. The result of four specific sequence capture probes, DENV1, 2, 3, 4 were CACCAGGGGAAGCTGTACCCTGGTGGT, GTGAGATGAAGCTGTAGTCTCACTGG, GCACTGAGGGAAGCTGTACCTCCTTGCA, AGCCAGGAGGAAGCTGTACTTCTGGTGG. Application to fabricated NALF gave no cross hybridization with high stringency buffer assay.Keywords : capture probe; dengue virus;  hybridization; nucleic acid lateral flow; serotyping
Glycerol Reduces Cross Hybridization on Nitrocellulose Membrane Narendra Yoga Hendarta; Abu Tholib Aman; Asmarani Kusumawati; Tri Wibawa
Jurnal Sain Veteriner Vol 38, No 3 (2020): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.44895

Abstract

Lateral flow assay (LFD) based nucleic acid lateral flow (NALF)  method has been developed recently. The method met point of care testing (POCT) as simple and rapid procedures, less equipment, and can be performance by less skilled technician. NALF based on nucleic acid hybridizationis  more economical then immunochromatography assay which use antibody-antigen recognition. Cross hybridization has issued while used to differentiate organism with high GC content and high homology as high similarity genome. Some techniques has applied to give high stringency condition avoid cross hybridization reaction but need more procedure to apply. We found glycerol applied to buffer assay could reduce cross hybridization on nitrocellulose membrane. The study used 2 kinds of high stringency buffer as PBS and SSC bases and high concentration of ssDNA amplicon as sample. Without glycerol ingredient gave cross hybridization signal on test line. But used glycerol could reduce those even omitted with PBS based buffer assay. Beside those, glycerol could significantly increased hybridization signal in SSC based buffer assay (p<0.05).