Abu Tholib Aman
Department Of Microbiology, Faculty Of Medicine, Public Health And Nursing, Universitas Gadjah Mada, Yogyakarta, Indonesia

Published : 14 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 14 Documents
Search

Genotyping of Rotavirus by Using RT-PCR Methods Nirwati, Hera; Wibawa, Tri; Aman, Abu Tholib; Soenarto, Yati
Indonesian Journal of Biotechnology Vol 18, No 1 (2013)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (167.791 KB)

Abstract

There is a great diversity of rotavirus genotypes circulating worldwide, with dominant genotypes changing from year to year. Rotavirus genotyping was performed by using reverse transcription PCR with type-specifi c-primers. Since rotavirus is a RNA virus that has high mutation rate, there was a possibility of technical diffi culty in genotyping due to mutation in the primer binding sites. During Indonesian rotavirus surveillance study 2006-2009, it was reported that 17% of samples subjected for G type and 21% of samplessubjected for P type were untypeable. The objective of this study was to identify genotypes of the samples that were untypeable previously using RT-PCR based on the method described by Das et al. (1994) and Gentsch et al. (1992). There were 30 samples subjected to G type and 61 samples subjected to P type to be re-typed using method described by Gouvea et al. (1990) and Simmond et al. (2008) for G and P typing, respectively. By using another set of primer, the genotype of all samples was identifi ed. This study highlights the importance of a constant reconsideration of primer sequences employed for the molecular typing of rotaviruses.Key words: rotavirus, G typing, P typing
High Frequency Spontaneous Deletions within the IcaADBC Operon of Clinical Staphylococcus epidermidis Isolates. Nuryastuti, Titik; van der Mei, Henny C.; Busscher, Henk J.; Kuijer, Roel; Aman, Abu Tholib; P. Krom, Bastiaan
Indonesian Journal of Biotechnology Vol 17, No 2 (2012)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (206.791 KB)

Abstract

Staphylococcus epidermidis has been shown to undergo a phase variation correlating with expression of the icaADBC operon which contributes to biofilm formation. Biofilm formation of Enterococcus faecalis is related to heterogeneity in electrophoretic mobility. Here the relationship between phase variants of clinical isolates of S. epidermidis, icaADBC presence and electrophoretic mobility distributions is investigated. Of 105 S. epidermidis clinical isolates, 5 showed phase variation on Congo Red agar plate. Biofilm forming capability of the blackcolonies and inability of the red colonies were confirmed using a microtiter plate assay and confocal laser scanning microscopy. Upon analysis of electrophoretic mobility distributions, the black colonies displayed heterogeneity at pH 2 which was absent in the red colonies of the same strain. Surprisingly, it was shown that in all red colonies had lost the icaADBC genes. Determination of gene copy number using Real Time PCR targeting icaA showed reduction of gene copy within a culture with phase variation. In conclusion, using three fundamentally different approaches phase variation of the five clinical isolates was observed. Variants appeared through loss of icaA and icaC gens. To our knowledge this is the first report indicating S. epidermidis strains irreversible switching from biofilm + to biofilm – phenotype by deletion of ica genes. Key words: deletion, ica genes, Staphylococcus epidermidis, IcaADBC operon
The Factors Associated with Food Safety Practices on Food Handlers in Primary School Canteens Suryani, Dyah; Sutomo, Adi Heru; Aman, Abu Tholib
Unnes Journal of Public Health Vol 8 No 1 (2019): Unnes Journal of Public Health
Publisher : Universitas Negeri Semarang in cooperation with Association of Indonesian Public Health Experts (Ikatan Ahli Kesehatan Masyarakat Indonesia (IAKMI))

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (129.369 KB) | DOI: 10.15294/ujph.v8i1.22830

Abstract

Abstract Foodborne disease is one of the major health problems in the world wide as well as in Indonesia. Children are a group that is susceptible to this disease due to consuming unsafe foods because of their lack of knowledge. Unsafe food is identified from contamination of microorganism or chemical compounds. The purpose of this study was to determine the factors associated with food safety practices on food handlers in primary school canteens in Yogyakarta City. This research was conducted using an observational analytic study with cross sectional design. Samples in this study were 109 food handlers from 60 primary schools in Yogyakarta City. The research results showed that there was no association between gender (p=0.327), age (p=0.144), level of education (p=0.718), experience (0.220), training (p=0.180), level of knowledge (p=0.143) with food safety practices on food handlers. There was an association between attitude (p=0.031) with food safety practices on food handlers in primary school canteens in Yogyakarta City. Abstrak Penyakit bawaan makanan merupakan salah satu permasalahan kesehatan masyarakat di dunia maupun di Indonesia. Anak-anak merupakan kelompok yang rentan terhadap penyakit tersebut dikarenakan mengkonsumsi makanan yang tidak aman akibat ketidaktahuannya. Makanan tidak aman ditandai dengan kontaminasi mikroorganisme maupun senyawa kimia. Penelitian ini bertujuan untuk mengetahui faktor-faktor yang berhubungan dengan praktek keamanan makanan pada penjamah makanan di kantin sekolah dasar wilayah Kota Yogyakarta. Penelitian ini merupakan penelitian observasional analitik dengan rancangan cross sectional. Sampel penelitian ini berjumlah 109 penjamah makanan dari 60 sekolah dasar di wilayah Kota Yogyakarta. Hasil penelitian menunjukkan bahwa tidak ada hubungan antara jenis kelamin (p=0,327), umur (p=0,144), tingkat pendidikan (p=0,718), pengalaman (0,220), pelatihan (p=0,180), tingkat pengetahuan (p=0,143) dengan praktek keamanan makanan pada penjamah makanan. Ada hubungan antara sikap (p=0,031) dengan praktek keamanan makanan pada penjamah makanan di kantin sekolah dasar wilayah Kota Yogyakarta.
High Frequency Spontaneous Deletions within the IcaADBC Operon of Clinical Staphylococcus epidermidis Isolates. Titik Nuryastuti; Henny C. van der Mei; Henk J. Busscher; Roel Kuijer; Abu Tholib Aman; Bastian P. Krom
Indonesian Journal of Biotechnology Vol 17, No 2 (2012)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (206.791 KB) | DOI: 10.22146/ijbiotech.7856

Abstract

Staphylococcus epidermidis has been shown to undergo a phase variation correlating with expression of the icaADBC operon which contributes to biofilm formation. Biofilm formation of Enterococcus faecalis is related to heterogeneity in electrophoretic mobility. Here the relationship between phase variants of clinical isolates of S. epidermidis, icaADBC presence and electrophoretic mobility distributions is investigated. Of 105 S. epidermidis clinical isolates, 5 showed phase variation on Congo Red agar plate. Biofilm forming capability of the blackcolonies and inability of the red colonies were confirmed using a microtiter plate assay and confocal laser scanning microscopy. Upon analysis of electrophoretic mobility distributions, the black colonies displayed heterogeneity at pH 2 which was absent in the red colonies of the same strain. Surprisingly, it was shown that in all red colonies had lost the icaADBC genes. Determination of gene copy number using Real Time PCR targeting icaA showed reduction of gene copy within a culture with phase variation. In conclusion, using three fundamentally different approaches phase variation of the five clinical isolates was observed. Variants appeared through loss of icaA and icaC gens. To our knowledge this is the first report indicating S. epidermidis strains irreversible switching from biofilm + to biofilm – phenotype by deletion of ica genes. Key words: deletion, ica genes, Staphylococcus epidermidis, IcaADBC operon
Genotyping of Rotavirus by Using RT-PCR Methods Hera Nirwati; Tri Wibawa; Abu Tholib Aman; Yati Soenarto
Indonesian Journal of Biotechnology Vol 18, No 1 (2013)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (167.791 KB) | DOI: 10.22146/ijbiotech.7863

Abstract

There is a great diversity of rotavirus genotypes circulating worldwide, with dominant genotypes changing from year to year. Rotavirus genotyping was performed by using reverse transcription PCR with type-specifi c-primers. Since rotavirus is a RNA virus that has high mutation rate, there was a possibility of technical diffi culty in genotyping due to mutation in the primer binding sites. During Indonesian rotavirus surveillance study 2006-2009, it was reported that 17% of samples subjected for G type and 21% of samplessubjected for P type were untypeable. The objective of this study was to identify genotypes of the samples that were untypeable previously using RT-PCR based on the method described by Das et al. (1994) and Gentsch et al. (1992). There were 30 samples subjected to G type and 61 samples subjected to P type to be re-typed using method described by Gouvea et al. (1990) and Simmond et al. (2008) for G and P typing, respectively. By using another set of primer, the genotype of all samples was identifi ed. This study highlights the importance of a constant reconsideration of primer sequences employed for the molecular typing of rotaviruses. Key words: rotavirus, G typing, P typing
Serotype Specific Sequence for Multi Test Line Nucleic Acid Lateral Flow Development Narendra Yoga Hendarta; Asmarani Kusumawati; Tri Wibawa; Abu Tholib Aman
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.44696

Abstract

Dengue virus that causes dengue fever and dengue shock syndrome has 4 different serotypes. Serotyping is needed for diagnosing and surveillance activities of disease spreaders. Recently, the Nucleic Acid Lateral Flow (NALF) method has been developed to confirm the results of easy amplification without complicated equipment. The aim of this study was designing capture probe for serotyping dengue virus (DENV) using NALF method. We have conducted an analytical study to obtain four specific sequences of Dengue Virus serotypes to develop serotipe specific NALF. Several parameters were used to analyzed Dengue genome sequences i.e % GC content, target homology, length of 100% homology continue of non-specific bases, hybridization temperature, and secondary structure to estimate the probe's capture capability in the hybridization reaction. The capture probes were applied to NALF and assayed using single strand DNA sample to check its performance. The result of four specific sequence capture probes, DENV1, 2, 3, 4 were CACCAGGGGAAGCTGTACCCTGGTGGT, GTGAGATGAAGCTGTAGTCTCACTGG, GCACTGAGGGAAGCTGTACCTCCTTGCA, AGCCAGGAGGAAGCTGTACTTCTGGTGG. Application to fabricated NALF gave no cross hybridization with high stringency buffer assay.Keywords : capture probe; dengue virus;  hybridization; nucleic acid lateral flow; serotyping
Glycerol Reduces Cross Hybridization on Nitrocellulose Membrane Narendra Yoga Hendarta; Abu Tholib Aman; Asmarani Kusumawati; Tri Wibawa
Jurnal Sain Veteriner Vol 38, No 3 (2020): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.44895

Abstract

Lateral flow assay (LFD) based nucleic acid lateral flow (NALF)  method has been developed recently. The method met point of care testing (POCT) as simple and rapid procedures, less equipment, and can be performance by less skilled technician. NALF based on nucleic acid hybridizationis  more economical then immunochromatography assay which use antibody-antigen recognition. Cross hybridization has issued while used to differentiate organism with high GC content and high homology as high similarity genome. Some techniques has applied to give high stringency condition avoid cross hybridization reaction but need more procedure to apply. We found glycerol applied to buffer assay could reduce cross hybridization on nitrocellulose membrane. The study used 2 kinds of high stringency buffer as PBS and SSC bases and high concentration of ssDNA amplicon as sample. Without glycerol ingredient gave cross hybridization signal on test line. But used glycerol could reduce those even omitted with PBS based buffer assay. Beside those, glycerol could significantly increased hybridization signal in SSC based buffer assay (p<0.05).
Extended spectrum beta lactamase (ESBL)-producing Klebsiella pneumoniae clinical isolates and its susceptibility pattern to antibiotics at Dr. Soeradji Tirtonegoro General Hospital Klaten, Central Java Kian Sinanjung; Hera Nirwati; Abu Tholib Aman
Journal of the Medical Sciences (Berkala Ilmu Kedokteran) Vol 52, No 1 (2020)
Publisher : Journal of the Medical Sciences (Berkala Ilmu Kedokteran)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (26.624 KB) | DOI: 10.19106/JMedSci005201202003

Abstract

Globally, the prevalence of Klebsiella pneumoniae (K. pneumonia) producing extended spectrum beta lactamase (ESBL) has been increasing steadily. The susceptibility patterns of ESBL-producing K. pneumonia varies considerably among countries. Therefore, the investigation of ESBL-producing K. pneumoniae in clinical isolates and their susceptibility are warranted. This research aimed to determine the proportion of ESBL-producing K. pneumoniae and the antibiotic susceptibility patterns of clinical isolates from Dr. Soeradji Tirtonegoro General Hospital, Klaten, Central Java. Identification of K. pneumoniae was performed by analyzing colony morphology, microscopic examination, and biochemical testing using Microbact. Both antibiotic susceptibility testing and ESBL screening (using ceftazidime, cefotaxime, and ceftriaxone discs) were conducted using disc diffusion method according to CLSI. The positive results were confirmed with modified double disk synergy (MDDST) using amoxicillin-clavulanate, ceftazidime, cefotaxime, and cefepime discs. From 962 clinical bacterial isolates, 168 (17.46%) isolates were identified as K. pneumoniae, during June 2017-May 2018. K. pneumoniae was mainly isolated from the Intensive Care Units (ICU) (29.17%) and with sputum being the most common specimen (45.24%). Overall ESBL producers were 52.98%, with the majority from ICU (41.57%) and isolated from sputum specimens (40.45%). ESBL-producing K. pneumoniae showed high resistance to many antibiotics. The sensitivity of ESBL-producing K. pneumoniae isolated from respiratory tract samples against piperacillin-tazobactam, amikacin, and meropenem was more than 80%. In conclusion, among all K. pneumoniae isolates, ESBL K. pneumoniae was 52.98%. ESBL K. pneumoniae from respiratory tract specimens had a sensitivity of more than 80% against piperacillin-tazobactam, amikacin, and meropenem.
A fatal acute appendicitis with sepsis and pneumonia was caused by melioidosis: a case report Abu Tholib Aman; Yuli Mawarti; Agus Barmawi; Faisal Heryono; Rizka Humardewayanti Asdie
Journal of the Medical Sciences (Berkala Ilmu Kedokteran) Vol 52, No 2 (2020)
Publisher : Journal of the Medical Sciences (Berkala Ilmu Kedokteran)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (2922.603 KB) | DOI: 10.19106/JMedSci0052022020010

Abstract

We report anunderdiagnosed fatal case of melioidosis that involved dygestion system which complicated with pneumonia, and sepsis. The case was initially diagnosed as acute appendicitis, and subsequently the patient underwent an exploratory laparatomy and appendectomy. He was discharged afer 3 days of hospitalization. Thirty days afterward, he was admitted to another private hospital to experience another exploratory laparatomy with indication of pancreatitis, intra-abdominal organs adhesions, and postoperative enterocutaneous fistula (ECF), and hospitalized there for 25 days. He eventually suffered from sepsis, pneumonia, unclosed ECF, anemia, hypoalbuminemia, and electrolyte imbalance. He then referred to a tertiary teaching hospital and hospitalized there for a total 134 days until he passed away. His clinical condition was declining, despite a long course of broad spectrum antibiotics. Treatment delay, prolong hospitalization, and complications were the inevitable, although Burkholderia pseudomallei was finally identified 2 weeks prior to his death. This case highlight that melioidosis canassociate with acute appendicitis, and that the delay on its diagnosis and treatment may trigger complications and death.
The rotavirus causing acute gastroenteritis in children of under 5-year of age in Indonesia 1972-2018: a review Abu Tholib Aman
Journal of the Medical Sciences (Berkala Ilmu Kedokteran) Vol 53, No 1 (2021)
Publisher : Journal of the Medical Sciences (Berkala Ilmu Kedokteran)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (38.498 KB) | DOI: 10.19106/JMedSci005301202105

Abstract

The reason of this review is the absence of thorough information of rotavirusinfection that had been the major cause of severe diarrhea in children of under5-years of age in Indonesia, despite numerous publications elaborating rotavirusinfection in some geographic areas of Indonesia. A review was conductedtowards 52 published articles covering rotavirus research in Indonesia duringperiod of 1972-2018.A thirty three selected articles were match with reviewcriteria which comprises rotavirus positive rate, clinical features, and severityof rotavirus infection, as well as genotypes of the rotavirus. Rotavirus has beenknown as the major cause of severe diarrhea among children under 5 years ofage world wide including in Indonesia. The rotavirus positive rates were rangefrom 31.1 to 90.9%, which variably to different subject’s population, studycriteria and methods, and time. Rotavirus can cause severe diarrhea withmajority of infected children suffered from dehydration, vomiting, and fever.The first genotyping conducted in Indonesia in the early 1980s revealed thepredominant genotypes were G3 and G4, followed by G2, and small proportionof G1 and mixed genotypes. However the following decades G1 and G2 were onthe raise with G3 predominantly re-appeared on 2015. G9 was first identified in2004, and occasionally detected until 2015. The P genotyping revealed P[4], P[6],and P[8] were the common genotypes detected. Mixed and untyped genotypeswere also detected in various proportion. Rotavirus diarrhea is a vaccinationpreventable disease, after natural infection, the immune system will produceprotective antibodies that will protect from infection of both homotypic andheterotypic, however homotypic infection will protect stronger. Therefore thisreview recommends continuous rotavirus genotypes surveillance in Indonesia.