Article Per Year (5 Year)
p-Index From 2020 - 2025
0.23
P-Index
This Author published in this journals
All Journal Indonesian Journal of Chemistry
Sudibyo Martono
Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Universitas Gadjah Mada, Yogyakarta, 55281, Indonesia
Chemical Engineering, Chemistry & Bioengineering Chemistry

Published : 1 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 1 Documents
Search

 1 
The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy Nina Salamah; Yuny Erwanto; Sudibyo Martono; Abdul Rohman
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.60413

Abstract

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.
Co-Authors Abdul Rohman Nina Salamah Yuny Erwanto