The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

Nina Salamah (Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Universitas Gadjah Mada, Yogyakarta, 55281, Indonesia Department of Analytical Chemistry, Faculty of Pharmacy, Universitas Ahmad Dahlan, Jl. Prof Soepomo, Janturan Yogyakarta 55164, Indone)
Yuny Erwanto (Division of Animal Products Technology, Faculty of Animal Science, Universitas Gadjah Mada, Jl. Fauna No. 3, Bulaksumur, Yogyakarta 55281, Indonesia Research Centre of Halal Products, Universitas Gadjah Mada, Jl. Kaliurang Km 4, Sekip, Yogyakarta 55)
Sudibyo Martono (Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Universitas Gadjah Mada, Yogyakarta, 55281, Indonesia)
Abdul Rohman (Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Universitas Gadjah Mada, Yogyakarta, 55281, Indonesia Research Centre of Halal Products, Universitas Gadjah Mada, Jl. Kaliurang Km 4, Sekip, Yogyakarta 55281, Indonesia)

Indonesian Journal of Chemistry
Vol 21, No 4 (2021)

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.