<![CDATA[ABSTRACT Sexually transmitted infections (STIs) remain a significant public health problem in Indonesia and worldwide, with syphilis and gonorrhea being two diseases that often occur concurrently. Early diagnosis of syphilis is crucial for preventing serious complications; however, commonly used serological tests for Treponema pallidum have limitations due to their lack of specificity. Bioinformatics offers a solution for developing more accurate molecular detection methods through genomic analysis and computer-aided primer design. This study aims to perform a bioinformatics analysis of the Treponema pallidum tprK gene as a target for molecular detection, as well as to design and validate specific primer pairs using an in silico PCR approach capable of distinguishing T. pallidum from Neisseria gonorrhoeae. The study was conducted using a bioinformatics approach through several stages: extraction and analysis of the tprK gene sequence from the GenBank database (AF343921.1); translation of the nucleotide sequence into a protein using BioEdit; modeling of the three-dimensional structure of the TprK protein using SWISS-MODEL; design and selection of primer pairs using Primer3Plus with parameters of 18–22 bp, Tm 55–60°C, and GC content 40–60%, analysis of primer characteristics using OligoCalc, and specificity testing via in silico PCR against 18 Treponema spp. genomes and 18 Neisseria spp. genomes. Bioinformatics analysis showed that the tprK gene (1,461 bp) encodes a 486-amino-acid protein with a stable 3-D structure. Of the five pairs of candidate primers designed, Pair 4 (forward: ACCGGGAAGTAAATGGCTGG, reverse: ATGCCCCTACGAATTGCCAA) and Pair 5 (forward: TTATGGGGCCTACCTGACCA, reverse: ACCAACGATACCCCAACGTC) exhibited the best characteristics with a length of 20 bp, Tm of 60.0–60.1°C, GC content of 45–55%, no secondary structure, and the ability to amplify 11 of 18 Treponema spp. genomes while failing to amplify any of the Neisseria spp. genomes tested. Bioinformatics analysis confirms that the tprK gene is a valid target for the detection of Treponema pallidum. Both designed primer pairs exhibited optimal technical characteristics and high specificity toward Treponema spp., thus showing potential for development as the basis for a more accurate molecular detection method for syphilis. However, further in vitro validation is required before clinical application. Keywords: Treponema Pallidum, Neisseria Gonorrhoeae, Bioinformatics, In Silico PCR, Sequence Analysis. ABSTRAK Infeksi Menular Seksual (IMS) masih menjadi masalah kesehatan masyarakat yang signifikan di Indonesia dan dunia, dengan sifilis dan gonore sebagai dua penyakit yang sering muncul bersamaan. Diagnosis dini sifilis sangat penting untuk mencegah komplikasi serius, namun pemeriksaan serologi untuk Treponema pallidum yang umum digunakan memiliki keterbatasan karena bersifat tidak spesifik. Pendekatan bioinformatika menawarkan solusi untuk mengembangkan metode deteksi molekuler yang lebih akurat melalui analisis genom dan desain primer berbasis komputer. Penelitian ini bertujuan untuk menganalisis secara bioinformatika gen tprK Treponema pallidum sebagai target deteksi molekuler serta merancang dan memvalidasi pasangan primer spesifik menggunakan pendekatan in silico PCR yang mampu membedakan T. pallidum dari Neisseria gonorrhoeae. Penelitian dilakukan dengan pendekatan bioinformatika melalui beberapa tahapan: ekstraksi dan analisis sekuen gen tprK dari basis data GenBank (AF343921.1), penerjemahan sekuen nukleotida menjadi protein menggunakan BioEdit, pemodelan struktur tiga dimensi protein TprK menggunakan SWISS-MODEL, desain dan seleksi pasangan primer menggunakan Primer3Plus dengan parameter 18-22 bp, Tm 55-60°C, dan GC 40-60%, analisis karakteristik primer menggunakan OligoCalc, serta uji spesifisitas melalui in silico PCR terhadap 18 genom Treponema spp. dan 18 genom Neisseria spp. Analisis bioinformatika menunjukkan gen tprK (1.461 bp) mengkode protein 486 asam amino dengan struktur 3-D stabil. Dari lima pasang primer kandidat yang didesain, Pair 4 (forward: ACCGGGAAGTAAATGGCTGG, reverse: ATGCCCCTACGAATTGCCAA) dan Pair 5 (forward: TTATGGGGCCTACCTGACCA, reverse: ACCAACGATACCCCAACGTC) memiliki karakteristik terbaik dengan panjang 20 bp, Tm 60,0-60,1°C, GC 45-55%, tanpa struktur sekunder, serta mampu mengamplifikasi 11 dari 18 genom Treponema spp. dan tidak mengamplifikasi seluruh genom Neisseria spp. yang diuji. Analisis bioinformatika membuktikan bahwa gen tprK merupakan target yang valid untuk deteksi Treponema pallidum. Kedua pasangan primer hasil desain menunjukkan karakteristik teknis yang optimal dan spesifisitas tinggi terhadap Treponema spp., sehingga berpotensi dikembangkan sebagai dasar metode deteksi molekuler sifilis yang lebih akurat. Namun demikian, diperlukan validasi in vitro lebih lanjut sebelum aplikasi klinis. Kata Kunci: Treponema Pallidum, Neisseria Gonorrhoeae, Bioinformatika, PCR In Silico, Analisis Sekuen.]]>
