ABSTRAK: Resistensi fluoroquinolone (FQ) pada Multi Drug Resistant Tuberculosis (MDR-TB) umumnya disebabkan oleh adanya sejumlah mutasi pada beberapa gen yang mengkode sensitivitas Mycobacterium tuberculosis dan sebagian besar terjadi pada gen gyrA. Mutasi pada kodon 94 gen gyrA merupakan mutasi yang paling sering terjadi dengan 7 variasi perubahan asam amino. Resistensi FQ dapat dideteksi menggunakan DNA probe yang spesifik agar dapat memberi terapi yang tepat pada pasien. Penelitian ini akan mendesain urutan nukleotida TaqMan probe menggunakan program Clone Manager Suite 9.2. Hasil rancangan DNA probe kemudian dianalisis dalam 2 tahap. Tahap pertama berdasarkan kriteria probe secara umum yaitu panjang (18-30 basa), %GC (40-60%), Tm (5-10°C lebih tinggi dibanding Tm primer), runs (? 4), repeats (? 4), dimer (? 4), dan tidak terbentuk hairpin. Selanjutnya tahap kedua berdasarkan kriteria pelabelan TaqMan probe, yaitu tidak terdapat basa G pada 2 nukleotida di ujung 5’ dan jumlah basa C ? G. Rancangan DNA probe mutan menggunakan program menghasilkan 1 probe untuk mutasi spesifik D94G. Probe tersebut dianalisa dengan kriteria probe secara umum dan kriteria pelabelan TaqMan probe. Kesimpulan dari penelitian ini yaitu hasil rancangan probe mutan A94MG1 dengan urutan 5’ – TCGATCTACGGCAGCCTGGT – 3’ telah memenuhi kriteria pelabelan TaqMan probe dan dapat digunakan untuk mendeteksi adanya mutasi pada kodon 94 gen gyrA Mycobacterium tuberculosis. Kata kunci: MDR-TB, gen gyrA, in silico, TaqMan probe, Real-Time PCR ABSTRACT: Fluoroquinolone (FQ) resistance in Multi Drug Resistant Tuberculosis (MDR-TB is generally caused by some mutations in several genes that encode the sensitivity of Mycobacterium tuberculosis and most of them occur in gyrA gene. Mutations in codon 94 gyrA gene are the most common mutations with 7 variations in amino acid changes. FQ resistance can be detected using a spesific DNA probe to provide the precise therapy for the patient. This research will design the TaqMan probe nucleotide sequence using the Clone Manager Suite 9.2. program. The results of designing DNA probes were then analyzed by 2 stages. The first stage is based on criteria of the probe in general which is length (18-30 bases), GC% (40-60%), Tm (5-10°C higher than primer Tm), runs (? 4), repeats (? 4), dimer (? 4), and hairpin is not formed. Second stage is examination based on the labeling criteria for TaqMan, that is no G base at 2 nucleotides at the end of 5’ and the amount of bases C ? G. The mutant DNA probe design using the program produced 1 probe for the D94G specific mutation. The probe was analyzed with general criteria and TaqMan probe labeling. The conclusion of this study is A94MG1 mutant probe design have met the TaqMan probe labeling criteria and can be used to detect mutations in the Mycobacterium tuberculosis gyrA gene codon 94.
Copyrights © 2019