Claim Missing Document
Check
Articles

The Active Fractions from Ethanol Extracts of Gracilaria Coronopifolia J Agardh Are Potential Free Radical Scavenging Agents I Made Dira Swantara; Sagung Chandra Yowani ; Osamu Iitsuka
Journal of Applied Chemical Science Volume 1, No. 2 , 2012
Publisher : Journal of Applied Chemical Science

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Six compounds in one fraction of seaweed Gracilaria coronopifolia (Red algae) that have radicalscavenging activity have been identified. Extraction of those compounds was carried out by maceration method using 96% ethanol. Separation and purification of the fraction were performed by liquid-liquid partition and column chromatographic methods. The obtained fractions were treated with 2,2-diphenyl-1- picrylhydrazyl and found that their radical-scavenging activities of the first (A) and the second (B) fractions from the column with a 60 min retention time were 83.12% and 90.72%, respectively. The compounds contained in the A and B fractions identified by GC-MS were 1-nonadecene; hexadecanoic acid or palmitic acid; octadec-9-enoic acid; cholesta-4,6-dien-3β-ol; cholest-5-en-3β-ol or cholesterol; and cholest-4-en-3- one. These compounds could be expected to have radical scavenging activities.
Penilaian Kualitas Hidup Pasien Kanker Serviks dengan Kemoterapi Paklitaksel–Karboplatin di RSUP Sanglah Tunas, I Ketut; Yowani, Sagung C.; Indrayathi, Putu A.; Noviyani, Rini; Budiana, I Nyoman G.
Indonesian Journal of Clinical Pharmacy Vol 5, No 1 (2016)
Publisher : Indonesian Journal of Clinical Pharmacy

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (310.193 KB) | DOI: 10.15416/ijcp.2016.5.1.35

Abstract

Pemberian kemoterapi pada pasien kanker serviks stadium IIB-IIIB selain menimbulkan efek terapi juga menimbulkan efek samping berupa penurunan kualitas hidup. Penelitian ini dilakukan pada Februari–Juni 2014 di Bagian Obstetri dan Gineklogi RSUP Sanglah Denpasar secara observasional dengan metode case study prospective. Pengumpulan data dilakukan menggunakan kuesioner EORTC QLQ C30 yang dikombinasikan dengan wawancara sebelum dan setelah kemoterapi paklitaksel-karboplatin sebanyak 3 seri pada pasien kanker serviks sel skuamosa stadium IIB-IIIB. Penelitian kualitas hidup dilakukan secara umum dan pada 15 domain yang memengaruhi kualitas hidup. Terdapat 12 pasien yang memenuhi kriteria inklusi. Pemberian kemoterapi regimen paklitaksel-karboplatin dapat meningkatkan kualitas hidup dengan penurunan nilai mean dari 48,083±5,451 menjadi 44,083±3,872. Terdapat perbedaan bermakna pada nilai kualitas hidup pasien sebelum dan setelah kemoterapi paklitaksel-karboplatin (nilai p=0,038). Terdapat penurunan kualitas hidup pada domain mual muntah, penurunan nafsu makan, fatigue, dan fungsi sosial. Domain dengan peningkatan kualitas hidup yaitu nyeri, fungsi fisik, fungsi emosional, sulit tidur, dan kesulitan keuangan. Pemberian kemoterapi paklitaksel-karboplatin pada 12 pasien dapat meningkatkan kualitas hidup pasien kanker serviks.Kata kunci: Domain kualitas hidup, kanker serviks, kualitas hidup, paklitaksel-karboplatinThe Assessment Quality of Life For Patients with Cervical Cancer Using Chemotherapy Paclitaxel-Carboplatin in Sanglah Chemotherapy administration to patients with cervical cancer stage IIB-IIIB not only causing a therapeutic effect but also decrease in quality of life. This study was conducted in February–June 2014 in the Department of Obstetrics and Gynecology Sanglah Hospital with observational prospective case study method. Data were collected using the EORTC QLQ C30 questionnaire combined with interview before and after chemotherapy paclitaxel-carboplatin as much as 3 series in patients with squamous cell cervical cancer stage IIB-IIIB. Assesment was done in general quality of life and 15 domains that affect the quality of life. There were 12 patients who met the inclusion criteria. Administration chemotherapy with paclitaxel-carboplatin can improve the quality of life shown by decrease mean value from 48.083±5.451 to 44.083±3.872. There were significant differences in the value of the quality of life before and after being given chemotherapy paclitaxel-carboplatin (p-value 0.038). There were decrease in the quality of life of the domain nausea, vomiting, decreased appetite, fatigue, and social functions. Domains that have increased the quality of life is pain, physical functioning, emotional functioning, sleeplessness, and financial difficulties. Administration of chemotherapy paclitaxel-carboplatin can improve the quality of life of patients with cervical cancer.Key words: Domain quality of life, cervical cancer, paclitaxel-carboplatin, quality of life
Identifikasi Mutasi Gen rpob Isolat MDR Mycobacterium tuberculosis di Bali dengan Metode Nested PCR*) Identification Of rpob Gene Mutation of MDR Mycobacterium tuberculosis Isolate in Bali Using Nested PCR Yowani, Sagung Chandra; Yowani, Sagung Chandra; Wirajana, I Nengah
JFIOnline | Print ISSN 1412-1107 | e-ISSN 2355-696X Vol 7, No 2 (2014)
Publisher : Indonesian Research Gateway

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK Tuberkulosis merupakan salah satu penyakit infeksi yang menjadi perhatian untuk ditangani pada program Millenium Development Goals (MDGs), terutama oleh meningkatnya kejadian Multi Drug Resistance (MDR_TB). Menurut WHO, resistensi terhadap rifampisin dan isoniazid telah dikategorikan sebagai MDR-TB. Dari beberapa penelitian, ditemukan bahwa hampir 90 % isolat yang resisten rifampisin, juga resisten terhadap isoniazid. Oleh karena itu,resistensi terhadap rifampisin dianggap sebagai marka penentu (surrogate marker) kejadian MDR-TB. Resistensi terhadap rifampisin dimediasi oleh adanya mutasi pada suatu region 81 bp (RRDR : Rifampicin Resistance Determinant Region) dari gen rpoB. Penelitian ini bertujuan utamanya untuk mengeksplorasi mutasi pada gen rpoB dari MDR-TB yang terjadi pada penderita Tuberkulosis di Bali. Isolat MDR-TB yang digunakan pada penelitian ini merupakanj koleksi Laboratorium Mikrobiologi RS Sanglah, Denpasar. Amplifikasi dilakukan dengan metode Nested Polymerase Chain Reaction menggunakan sepasang outer primer dan sepasang inner primer Hasil penelitian menunjukkan selain mutasi pada daerah RRDR, 5 dari 6 isolat yang dikerjakan memiliki titik mutasi yang sama yaitu pada kodon 418, dengan perubahan asam amino dari asam glutamat menjadi asam aspartat.Oleh karenanya, dapat disimpulkan bahwa terdapat missense mutation   Kata Kunci : Nested PCR, MDR-TB, Mutasi gen rpoB ABSTRACT Tuberculosis is one of the  infectious diseases that is important to be treated in Millenium Development Goals (MDGs) programme, mainly due to the increasing of Multidrug resistant tuberculosis (MDR-TB) cases. According to WHO, MDR-TB was defined as tuberculosis caused by strains of Mycobacterium tuberculosis that are resistant to at least isoniazid and rifampicin. Several studies found that nearly 90% of rifampin-resistant isolates, were also resistant to isoniazid. Therefore, resistance to rifampicin is a surrogate marker of MDR. Resistance to rifampicin is mediated by  mutation in a region of 81 bp (RRDR: Rifampicin Resistance Determinant Region) of the rpoB gene. The aim of this research mainly was to explore mutation of MDR-TB’ rpoB gene of tuberculosis patient in Bali. All MDR-TB isolates used for this research were the collection of Clinical Microbiology Laboratory Of Sanglah Hospital, Denpasar. Amplification were conducted by Nested Polymerase Chain Reaction methods using two pair of  inner and outer primers. The result of this study showed that except at RRDR, five of six isolates had one similar mutation at codon 418 from glutamic acid to aspartic acid. Therefore, it could be concluded that there has been a missense mutation in all isolates. Key words: Nested PCR, MDR-TB, r.poB gene mutation
Identifikasi Mutasi Gen rpob Isolat MDR Mycobacterium tuberculosis di Bali dengan Metode Nested PCR*) Identification Of rpob Gene Mutation of MDR Mycobacterium tuberculosis Isolate in Bali Using Nested PCR Yowani, Sagung Chandra; Yowani, Sagung Chandra; Wirajana, I Nengah
JFIOnline | Print ISSN 1412-1107 | e-ISSN 2355-696X Vol 7, No 2 (2014)
Publisher : Indonesian Research Gateway

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK Tuberkulosis merupakan salah satu penyakit infeksi yang menjadi perhatian untuk ditangani pada program Millenium Development Goals (MDGs), terutama oleh meningkatnya kejadian Multi Drug Resistance (MDR_TB). Menurut WHO, resistensi terhadap rifampisin dan isoniazid telah dikategorikan sebagai MDR-TB. Dari beberapa penelitian, ditemukan bahwa hampir 90 % isolat yang resisten rifampisin, juga resisten terhadap isoniazid. Oleh karena itu,resistensi terhadap rifampisin dianggap sebagai marka penentu (surrogate marker) kejadian MDR-TB. Resistensi terhadap rifampisin dimediasi oleh adanya mutasi pada suatu region 81 bp (RRDR : Rifampicin Resistance Determinant Region) dari gen rpoB. Penelitian ini bertujuan utamanya untuk mengeksplorasi mutasi pada gen rpoB dari MDR-TB yang terjadi pada penderita Tuberkulosis di Bali. Isolat MDR-TB yang digunakan pada penelitian ini merupakanj koleksi Laboratorium Mikrobiologi RS Sanglah, Denpasar. Amplifikasi dilakukan dengan metode Nested Polymerase Chain Reaction menggunakan sepasang outer primer dan sepasang inner primer Hasil penelitian menunjukkan selain mutasi pada daerah RRDR, 5 dari 6 isolat yang dikerjakan memiliki titik mutasi yang sama yaitu pada kodon 418, dengan perubahan asam amino dari asam glutamat menjadi asam aspartat.Oleh karenanya, dapat disimpulkan bahwa terdapat missense mutation   Kata Kunci : Nested PCR, MDR-TB, Mutasi gen rpoB ABSTRACT Tuberculosis is one of the  infectious diseases that is important to be treated in Millenium Development Goals (MDGs) programme, mainly due to the increasing of Multidrug resistant tuberculosis (MDR-TB) cases. According to WHO, MDR-TB was defined as tuberculosis caused by strains of Mycobacterium tuberculosis that are resistant to at least isoniazid and rifampicin. Several studies found that nearly 90% of rifampin-resistant isolates, were also resistant to isoniazid. Therefore, resistance to rifampicin is a surrogate marker of MDR. Resistance to rifampicin is mediated by  mutation in a region of 81 bp (RRDR: Rifampicin Resistance Determinant Region) of the rpoB gene. The aim of this research mainly was to explore mutation of MDR-TB’ rpoB gene of tuberculosis patient in Bali. All MDR-TB isolates used for this research were the collection of Clinical Microbiology Laboratory Of Sanglah Hospital, Denpasar. Amplification were conducted by Nested Polymerase Chain Reaction methods using two pair of  inner and outer primers. The result of this study showed that except at RRDR, five of six isolates had one similar mutation at codon 418 from glutamic acid to aspartic acid. Therefore, it could be concluded that there has been a missense mutation in all isolates. Key words: Nested PCR, MDR-TB, r.poB gene mutation
Identifikasi Mutasi Gen rpob Isolat MDR Mycobacterium tuberculosis di Bali dengan Metode Nested PCR*) Identification Of rpob Gene Mutation of MDR Mycobacterium tuberculosis Isolate in Bali Using Nested PCR Yowani, Sagung Chandra; Yowani, Sagung Chandra; Wirajana, I Nengah
Jurnal Farmasi Indonesia Vol 7, No 2 (2014)
Publisher : Jurnal Farmasi Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35617/jfi.v7i2.165

Abstract

ABSTRAK Tuberkulosis merupakan salah satu penyakit infeksi yang menjadi perhatian untuk ditangani pada program Millenium Development Goals (MDGs), terutama oleh meningkatnya kejadian Multi Drug Resistance (MDR_TB). Menurut WHO, resistensi terhadap rifampisin dan isoniazid telah dikategorikan sebagai MDR-TB. Dari beberapa penelitian, ditemukan bahwa hampir 90 % isolat yang resisten rifampisin, juga resisten terhadap isoniazid. Oleh karena itu,resistensi terhadap rifampisin dianggap sebagai marka penentu (surrogate marker) kejadian MDR-TB. Resistensi terhadap rifampisin dimediasi oleh adanya mutasi pada suatu region 81 bp (RRDR : Rifampicin Resistance Determinant Region) dari gen rpoB. Penelitian ini bertujuan utamanya untuk mengeksplorasi mutasi pada gen rpoB dari MDR-TB yang terjadi pada penderita Tuberkulosis di Bali. Isolat MDR-TB yang digunakan pada penelitian ini merupakanj koleksi Laboratorium Mikrobiologi RS Sanglah, Denpasar. Amplifikasi dilakukan dengan metode Nested Polymerase Chain Reaction menggunakan sepasang outer primer dan sepasang inner primer Hasil penelitian menunjukkan selain mutasi pada daerah RRDR, 5 dari 6 isolat yang dikerjakan memiliki titik mutasi yang sama yaitu pada kodon 418, dengan perubahan asam amino dari asam glutamat menjadi asam aspartat.Oleh karenanya, dapat disimpulkan bahwa terdapat missense mutation   Kata Kunci : Nested PCR, MDR-TB, Mutasi gen rpoB ABSTRACT Tuberculosis is one of the  infectious diseases that is important to be treated in Millenium Development Goals (MDGs) programme, mainly due to the increasing of Multidrug resistant tuberculosis (MDR-TB) cases. According to WHO, MDR-TB was defined as tuberculosis caused by strains of Mycobacterium tuberculosis that are resistant to at least isoniazid and rifampicin. Several studies found that nearly 90% of rifampin-resistant isolates, were also resistant to isoniazid. Therefore, resistance to rifampicin is a surrogate marker of MDR. Resistance to rifampicin is mediated by  mutation in a region of 81 bp (RRDR: Rifampicin Resistance Determinant Region) of the rpoB gene. The aim of this research mainly was to explore mutation of MDR-TBâ?? rpoB gene of tuberculosis patient in Bali. All MDR-TB isolates used for this research were the collection of Clinical Microbiology Laboratory Of Sanglah Hospital, Denpasar. Amplification were conducted by Nested Polymerase Chain Reaction methods using two pair of  inner and outer primers. The result of this study showed that except at RRDR, five of six isolates had one similar mutation at codon 418 from glutamic acid to aspartic acid. Therefore, it could be concluded that there has been a missense mutation in all isolates. Key words: Nested PCR, MDR-TB, r.poB gene mutation
Identifikasi Mutasi Gen rpob Isolat MDR Mycobacterium tuberculosis di Bali dengan Metode Nested PCR*) Identification Of rpob Gene Mutation of MDR Mycobacterium tuberculosis Isolate in Bali Using Nested PCR Yowani, Sagung Chandra; Yowani, Sagung Chandra; Wirajana, I Nengah
Jurnal Farmasi Indonesia Vol 7, No 2 (2014)
Publisher : Jurnal Farmasi Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35617/jfi.v7i2.165

Abstract

ABSTRAK Tuberkulosis merupakan salah satu penyakit infeksi yang menjadi perhatian untuk ditangani pada program Millenium Development Goals (MDGs), terutama oleh meningkatnya kejadian Multi Drug Resistance (MDR_TB). Menurut WHO, resistensi terhadap rifampisin dan isoniazid telah dikategorikan sebagai MDR-TB. Dari beberapa penelitian, ditemukan bahwa hampir 90 % isolat yang resisten rifampisin, juga resisten terhadap isoniazid. Oleh karena itu,resistensi terhadap rifampisin dianggap sebagai marka penentu (surrogate marker) kejadian MDR-TB. Resistensi terhadap rifampisin dimediasi oleh adanya mutasi pada suatu region 81 bp (RRDR : Rifampicin Resistance Determinant Region) dari gen rpoB. Penelitian ini bertujuan utamanya untuk mengeksplorasi mutasi pada gen rpoB dari MDR-TB yang terjadi pada penderita Tuberkulosis di Bali. Isolat MDR-TB yang digunakan pada penelitian ini merupakanj koleksi Laboratorium Mikrobiologi RS Sanglah, Denpasar. Amplifikasi dilakukan dengan metode Nested Polymerase Chain Reaction menggunakan sepasang outer primer dan sepasang inner primer Hasil penelitian menunjukkan selain mutasi pada daerah RRDR, 5 dari 6 isolat yang dikerjakan memiliki titik mutasi yang sama yaitu pada kodon 418, dengan perubahan asam amino dari asam glutamat menjadi asam aspartat.Oleh karenanya, dapat disimpulkan bahwa terdapat missense mutation   Kata Kunci : Nested PCR, MDR-TB, Mutasi gen rpoB ABSTRACT Tuberculosis is one of the  infectious diseases that is important to be treated in Millenium Development Goals (MDGs) programme, mainly due to the increasing of Multidrug resistant tuberculosis (MDR-TB) cases. According to WHO, MDR-TB was defined as tuberculosis caused by strains of Mycobacterium tuberculosis that are resistant to at least isoniazid and rifampicin. Several studies found that nearly 90% of rifampin-resistant isolates, were also resistant to isoniazid. Therefore, resistance to rifampicin is a surrogate marker of MDR. Resistance to rifampicin is mediated by  mutation in a region of 81 bp (RRDR: Rifampicin Resistance Determinant Region) of the rpoB gene. The aim of this research mainly was to explore mutation of MDR-TBâ?? rpoB gene of tuberculosis patient in Bali. All MDR-TB isolates used for this research were the collection of Clinical Microbiology Laboratory Of Sanglah Hospital, Denpasar. Amplification were conducted by Nested Polymerase Chain Reaction methods using two pair of  inner and outer primers. The result of this study showed that except at RRDR, five of six isolates had one similar mutation at codon 418 from glutamic acid to aspartic acid. Therefore, it could be concluded that there has been a missense mutation in all isolates. Key words: Nested PCR, MDR-TB, r.poB gene mutation
AMPLICATION OF 0.7KB FRAGMENT KATG GENE FROM CLINICAL MULTI DRUG RESISTANT TUBERCULOSIS ISOLATE IN BALI Dwiputri, A. W.; Ratnayani, K.; Yowani, and S. C.
INDONESIAN JOURNAL OF BIOMEDICAL SCIENCES Vol 7 No 2 (2013): IJBS Vol2 No2
Publisher : Udayana University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (513.34 KB)

Abstract

During last decade has seen a particular increase in the occurrence of drug-resistant of tuberculosis (DR-TB) and multi-DR strains, such as Isoniazid (INH) resistant strains of M. tuberculosis.  INH resistance is more frequently associated with mutations in the katG gene. Detection of katG gene mutations can be performed by PCR technique, followed by sequences. The aim of this study is to amplify katG gene region (0,7 Kb) from clinical isolate of MDR-TB in Bali. DNA isolation for PCR was done by Boom method and katG gene amplification was performed under the following conditions: predenaturation at 950C for 15 min; fourty cycles of denaturation at 940C for 1 min, annealing at 560C for 1 min, extension at 720C for 2 min; final extension at 720C for 10 min. The amplicons were detected by 1.5% agarose gel electrophoresis and showed a specific band size at 0.7 kb. This suggests that the fragment of katG gene has been successfully amplified in these areas.
Penilaian Kualitas Hidup Pasien Kanker Serviks dengan Kemoterapi Paklitaksel–Karboplatin di RSUP Sanglah I Ketut Tunas; Sagung C. Yowani; Putu A. Indrayathi; Rini Noviyani; I Nyoman G. Budiana
Indonesian Journal of Clinical Pharmacy Vol 5, No 1 (2016)
Publisher : Universitas Padjadjaran

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (291.444 KB) | DOI: 10.15416/ijcp.2016.5.1.35

Abstract

Pemberian kemoterapi pada pasien kanker serviks stadium IIB-IIIB selain menimbulkan efek terapi juga menimbulkan efek samping berupa penurunan kualitas hidup. Penelitian ini dilakukan pada Februari–Juni 2014 di Bagian Obstetri dan Gineklogi RSUP Sanglah Denpasar secara observasional dengan metode case study prospective. Pengumpulan data dilakukan menggunakan kuesioner EORTC QLQ C30 yang dikombinasikan dengan wawancara sebelum dan setelah kemoterapi paklitaksel-karboplatin sebanyak 3 seri pada pasien kanker serviks sel skuamosa stadium IIB-IIIB. Penelitian kualitas hidup dilakukan secara umum dan pada 15 domain yang memengaruhi kualitas hidup. Terdapat 12 pasien yang memenuhi kriteria inklusi. Pemberian kemoterapi regimen paklitaksel-karboplatin dapat meningkatkan kualitas hidup dengan penurunan nilai mean dari 48,083±5,451 menjadi 44,083±3,872. Terdapat perbedaan bermakna pada nilai kualitas hidup pasien sebelum dan setelah kemoterapi paklitaksel-karboplatin (nilai p=0,038). Terdapat penurunan kualitas hidup pada domain mual muntah, penurunan nafsu makan, fatigue, dan fungsi sosial. Domain dengan peningkatan kualitas hidup yaitu nyeri, fungsi fisik, fungsi emosional, sulit tidur, dan kesulitan keuangan. Pemberian kemoterapi paklitaksel-karboplatin pada 12 pasien dapat meningkatkan kualitas hidup pasien kanker serviks.Kata kunci: Domain kualitas hidup, kanker serviks, kualitas hidup, paklitaksel-karboplatinThe Assessment Quality of Life For Patients with Cervical Cancer Using Chemotherapy Paclitaxel-Carboplatin in Sanglah Chemotherapy administration to patients with cervical cancer stage IIB-IIIB not only causing a therapeutic effect but also decrease in quality of life. This study was conducted in February–June 2014 in the Department of Obstetrics and Gynecology Sanglah Hospital with observational prospective case study method. Data were collected using the EORTC QLQ C30 questionnaire combined with interview before and after chemotherapy paclitaxel-carboplatin as much as 3 series in patients with squamous cell cervical cancer stage IIB-IIIB. Assesment was done in general quality of life and 15 domains that affect the quality of life. There were 12 patients who met the inclusion criteria. Administration chemotherapy with paclitaxel-carboplatin can improve the quality of life shown by decrease mean value from 48.083±5.451 to 44.083±3.872. There were significant differences in the value of the quality of life before and after being given chemotherapy paclitaxel-carboplatin (p-value 0.038). There were decrease in the quality of life of the domain nausea, vomiting, decreased appetite, fatigue, and social functions. Domains that have increased the quality of life is pain, physical functioning, emotional functioning, sleeplessness, and financial difficulties. Administration of chemotherapy paclitaxel-carboplatin can improve the quality of life of patients with cervical cancer.Key words: Domain quality of life, cervical cancer, paclitaxel-carboplatin, quality of life
DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB) DENGAN METODE POLYMERASE CHAIN REACTION Luk Ketut Budi Maitriani; I Nengah Wirajana; Sagung Chandra Yowani
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 3 No 3 (2015)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (230.013 KB)

Abstract

ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen). Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB) mencakup kodon 94 (nukleotida 280-282). Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077). Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR). Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit) serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen), meliputi: panjang primer, %GC, Tm (melting temperature), interaksi primer (dimers dan hairpins), stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA) 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA) 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.  ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen). The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB) clinical isolates include codon 94 (nucleotide 280-282). Codon 94 of inhA gene is frequently mutated position and can lead to coresistance of isoniazid and ethionamide. The primer was designed using sequences of inhA gene Mycobacterium tuberculosis from www.ncbi.nlm.nih.gov (bank genes: AF106077). Results obtained the best primer pair and tested in vitro using Polymerase Chain Reaction method. DNA template used were MDR-TB clinical isolate. Amplifying process was begun with predenaturation at 95°C for 15 minutes and followed by 45 cycles of amplification (denaturation at 94°C for 1 minutes, annealing at 56°C for 1 minute 20 seconds and extension at 72°C for 2 minutes) with a final extension at 72°C for 10 minutes. The PCR products were detected using 1,5% b/v agarose gel electrophoresis. In conclusion the best primer pair selected based on the criteria of the Clone Manager Suite 6 program (University of Groningen) such as: primer length, %GC, Tm (melting temperature), primers interaction (dimers and hairpins), stability, repeats, runs, and false priming. The primer sequence were forward primer (pF-inhA) 5’ CTGGTTAGCGGAATCATCAC 3' and reverse primer (pR-inhA) 5' CGACCGTCATCC-AGTTGTA 3' with the length 460 bp. ne if they are suitable for consumption according to the guideline by the Director General of Food and Drug Monitoring in terms of lead and cadmium contents. The study was conducted by collecting samples in the area of ??the Sungai Mati estuary and Pemogan area. Samples were prepared by wet destruction method using reverse aqua regia and were analysed using atomic absorption spectrophotometer (AAS) at 283,3 nm for Pb and 228,8 nm for Cd. The results show that all fruits investigated contain Pb and Cd with consentrations higher than the guideline.  
DESAIN DNA PELACAK SECARA IN SILICO SEBAGAI PENDETEKSI MUTASI PADA GEN embB Mycobacterium tuberculosis Ade Ari Sundari; Ni Putu Monica Rosdiana Dewi Paramitha; Sagung Chandra Yowani; Putu Sanna Yustiantara
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 8 No 1 (2020): Volume 8, Nomor 1, 2020
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK: Terapi lini pertama Tuberkulosis (TB) selalu menggunakan terapi kombinasi yaitu rifampisin, isoniazid, etambutol, dan pirazinamid. Penggunaan etambutol dalam terapi kombinasi TB digunakan untuk mencegah terjadinya resistensi terhadap obat lain namun tingkat resistensi etambutol secara bertahap meningkat. Mutasi pada operon embCAB bertanggung jawab pada resistensi etambutol dengan prevalensi tertinggi terjadi pada kodon 306 gen embB. Mutasi pada gen embB kodon 306 juga dikaitkan dengan adanya kecenderungan resistensi akibat peningkatan konsumsi obat sehingga dijadikan sebagai kandidat potential marker untuk board drug resistance, khususnya untuk MDR-TB. Penelitian ini akan mendesain urutan nukleotida TaqMan probe untuk mendeteksi mutasi M306I menggunakan program Clone Manager Suite 9.2. Hasil rancangan probe DNA kemudian dianalisis berdasarkan kriteria probe secara umum dan berdasarkan kriteria pelabelan TaqMan probe. Rancangan probe DNA mutan menggunakan program menghasilkan 10 probe yang memenuhi kriteria probe secara umum untuk mutasi M306I pada gen embB. Berdasarkan analisa pelabelan TaqMan probe, diperoleh 7 probe (E306MI4, E306MI5, E306MI6, E306MI7, E306MI9, E306MI10, dan E306MI13) untuk deteksi mutasi M306I pada gen embB. Hasil rancangan probe mutan yang telah memenuhi kriteria pelabelan TaqMan probe dapat digunakan untuk mendeteksi adanya mutasi kodon 306 gen embB Mycobacterium tuberculosis. Hasil perancangan TaqMan probe perlu diuji secara eksperimental untuk membuktikan efisiensi kerja dari probe tersebut agar dapat digunakan pada metode Real-Time PCR. ABSTRACT: First-line Tuberculosis (TB) therapy always uses combination therapy, such as rifampicin, isoniazid, ethambutol, and pyrazinamide. Ethambutol was effective for preventing treatment failures caused by Mycobacterium tuberculosis isolates resistant to other anti-TB drugs however, the resistance rate of ethambutol has gradually increased. Mutations in the embCAB operon have been identi?ed to confer resistance to ethambutol, with embB codon 306 being the most frequently affected. embB306 mutations are associated a tendency for resistance due to increasing numbers of antibiotics consumption so it may be a potential marker for broad drug resistance, especially for MDR-TB. This research design the TaqMan probe nucleotide sequence for the M306I spesific mutation using the Clone Manager Suite 9.2 program. The results of the DNA probe design were then analyzed based on probe criteria in general and based on the TaqMan probe labeling criteria. The mutant DNA probes design using the program produced 10 probes thats have met the general probe criteria for the M306I mutation in the embB gene. Based on the TaqMan probe labeling analysis, theres 7 probes (E306MI4, E306MI5, E306MI6, E306MI7, E306MI9, E306MI10 and E306MI13) for the detection of M306I mutations in the embB gene. The results of the mutant probe design that has met the TaqMan labeling criteria can be used to detect mutations in M. tuberculosis embB gene codon 306. The results of the TaqMan probe need to be tested experimentally to prove the working efficiency of the probe so that it can be used in the Real-Time PCR method.
Co-Authors A. W. Dwiputri Ade Ari Sundari Ade Ari Sundari Amelia Putri, Ni Luh Dian Saptari Arifani Siswidiasari Asmara A. A. R. Astuti, M.A.P. Ayu Nyoman Chandra Yustiana Cista Dewi, Ni Putu Fiona Dek Pueteri Dewi Suryani Deniariasih, N.W. Devi, Ni Wayan Antika Sri Devita Kusdianingrum Dewa Ayu Swastini Dewi Andayani Farmawati Dwicandra, N.M.O. Dyah Subadrika Warma Dewi Endang Kumolosasi Heni Pujiastuti I Gede Ketut Sajinadiyasa I Gusti A. A. Santhi Rahmaryani I Gusti Ayu Agung Septiari I Gusti Ngurah Anom Cahyadi Putra I Ketut Juniarta I Ketut Tunas I Made Dira Swantara I Made Oka Widyantara I Nengah Wirajana I Nyoman Gede Budiana I Nyoman Gede Budiana I Wayan Kasa Ida Ayu Alit Widhiartini Ida Ayu Gendari Ida Ayu Ratih Dwi Nugraha Putri Ida Bagus Nyoman Maharjana Ida Bagus Nyoman Putra Dwija Indra Juana Adikara Jennifer Tamara Jennifer Tamara Kadek Ratna Sari Dewi Kadek Widya Yuli Hartati Ketut Ratnayani Ketut Widyani Astuti Liangky Syane S Luh Arida Ayu Rahning Putri Luh Gede Astuti Luh Vida Sasmitha Luk Ketut Budi Maitriani M. A. Pratiwi Made Dharmesti Wijaya Made Rai Dwitya Wiradiputra Marlia Singgih Wibowo Mirawati N.K.W. Ni Kadek Ari Cipta Pratiwi Ni Kadek Ariani Ni Ketut Sri Anggreni Ni Komang Sasi Ani Ni Made Febrianti Ni Made Yustikarini Ni Nyoman Pradnya Utari Ni Putu Ariantari Ni Putu Intan Satya Dewi Ni Putu Monica Rosdiana Dewi Paramitha Ni Wayan Sukma Pramitha Sari1 Nurul Marfu’ah Osamu Iitsuka Pradnyaniti, D.G Putri, Ni Kadek Sri Adnyani Alit Putu Ayu Indrayathi Putu Lita Astriani Rasmaya Niruri Rini Noviyani Rini Noviyani Sang Ayu Putu Chika Iswari Anjani Saputra, Gusti Nyoman Oka Sari Dewi, Kadek Ratna Sudarma, I Wayan Ari Syamsul Arifin Tasya Pramiswari Tirtawati, Ni Putu Ayu Wijayakusuma, I Gusti Ngurah Lanang Yayanasri Yustiantara, Putu Sanna