Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati
Vol 15, No 3 (2010): October 2010

Kajian Molekuler Layu Buah Muda Kakao (Theobroma cacao L.): Ekspresi TcPIN1 Like Gene

Yohana Theresia Astuti (Unknown)
Kumala Dewi (Unknown)
Santosa Santosa (Unknown)
A. Adi Prawoto (Unknown)



Article Info

Publish Date
15 Oct 2019

Abstract

This experiment was carried out to evaluate the expression of TcPIN1 like gene in cocoa (Theobroma cacao L.). DNA and RNA were extracted from 7 weeks old of both healthy and cherelle wilt cocoa pods. PCR was done with two primer set based on PIN1 sequenced of Arabidopsis. Primer PIN1-1: Forward: taaggtgatgccaccaacaa; Reverse: gccatgaacaacccaagact. Primer PIN!-2: Forward: tttgtgtggagctcaagtgc; Reverse: ctgcgtcgttttgttgctta. RT-PCR was done with primer PIN1-2. The results showed that TcPIN1-2 like gene was found in healthy young pods, but not availabe in cherelle wilt pods of cocoa.

Copyrights © 2010






Journal Info

Abbrev

biota

Publisher

Subject

Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology

Description

Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati merupakan jurnal ilmiah yang memuat hasil-hasil penelitian, kajian-kajian pustaka dan berita-berita terbaru tentang ilmu dan teknologi kehayatian (biologi, bioteknologi dan bidang ilmu yang terkait). Biota terbit pertama kali bulan Juli 1995 dengan ISSN ...