Article Per Year (5 Year)
p-Index From 2021 - 2026
1.203
P-Index
This Author published in this journals
All Journal Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati Indonesian Journal of Biotechnology Bioeksperimen: Jurnal Penelitian Biologi Pendas : Jurnah Ilmiah Pendidikan Dasar Jurnal Bintang Pendidikan Indonesia Cendikia Pendidikan Riau Jurnal Teknik Informatika FUNDS: Jurnal Ilmiah Akutansi, Keuangan, dan Bisnis
Kumala Dewi
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Arts Humanities Biochemistry, Genetics & Molecular Biology Computer Science & IT Economics, Econometrics & Finance Education Immunology & microbiology Languange, Linguistic, Communication & Media Materials Science & Nanotechnology Mathematics Social Sciences Other

Published : 8 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 8 Documents
Search

 1 
Expression analysis of antioxidant genes in response to drought stress in the fl ag leaf of two Indonesian rice cultivars R. Refli; Sukarti Muljopawiro; Kumala Dewi; Diah Rachmawati
Indonesian Journal of Biotechnology Vol 19, No 1 (2014)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (279.254 KB) | DOI: 10.22146/ijbiotech.8633

Abstract

The objective of this study was to analysis the expression of antioxidant genes in response to droughtstress in Indonesian rice. The malondialdehyde (MDA) content and the expression of Cu-ZnSod1, cCu-ZnSod2,MnSod1, cApxa, cApxb, chl-sApx, Cat1, Cat2, Cat3, Gr1, Gr2, and Gr3 genes were assayed in the rice fl ag leaf ofCiherang and Situ Bagendit cultivars subjected to control, mild and severe drought during the grain fi llingphase. Increase in MDA content of Ciherang treated to mild and severe drought was almost two-fold andthree-fold respectively, while MDA content in Situ Bagendit subjected to mild and severe drought increasedapproximately one-fold and two-fold as compared to the control. The semi quantitative reverse transcriptionpolymerase chain reaction (sqRT-PCR) analysis showed that the expression of cCu-ZnSod1, MnSod1, Cat2, Gr3genes of Ciherang, and cCu-ZnSod2, MnSod1, cApxa, cApxb, chl-sAPX, Cat2 and Gr1 genes of Situ Bagendit increasedin fl ag leaf of plant treated to drought. Expressions of cApxb, chl-sApx, Cat3 of Ciherang and Cu-ZnSod1 and Gr2genes of Situ Bagendit were not changed signifi cantly by drought stress. Decreased expression was shownby cCu-ZnSod2, cApxa, Cat1, Gr1 and Gr2 genes of Ciherang, and Cat1, Cat3 and Gr3 genes of Situ Bagendit. Theresults indicated that the activity of oxidative defense was regulated by four genes; cCu-ZnSod1, MnSod1, Cat2,Gr3 in Ciherang, and eight genes; cCu-ZnSod1, cCu-ZnSod2, MnSod1, cApxa, cApxb, chl-sApx, Cat2 and Gr1 in SituBagendit. Therefore, differences in the number of antioxidant genes controlling oxidative defense systemmight determine the difference of the oxidative defense capacity between both cultivars in response to droughtstress during grain fi lling.
Kajian Molekuler Layu Buah Muda Kakao (Theobroma cacao L.): Ekspresi TcPIN1 Like Gene Yohana Theresia Astuti; Kumala Dewi; Santosa Santosa; A. Adi Prawoto
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v15i3.2591

Abstract

This experiment was carried out to evaluate the expression of TcPIN1 like gene in cocoa (Theobroma cacao L.). DNA and RNA were extracted from 7 weeks old of both healthy and cherelle wilt cocoa pods. PCR was done with two primer set based on PIN1 sequenced of Arabidopsis. Primer PIN1-1: Forward: taaggtgatgccaccaacaa; Reverse: gccatgaacaacccaagact. Primer PIN!-2: Forward: tttgtgtggagctcaagtgc; Reverse: ctgcgtcgttttgttgctta. RT-PCR was done with primer PIN1-2. The results showed that TcPIN1-2 like gene was found in healthy young pods, but not availabe in cherelle wilt pods of cocoa.
Paclobutrazol And Cytokinin Regulation On Culm Growht Of Black Rice (Oryza sativa L. “Cempo Ireng”) Darussalam Darussalam; Kumala Dewi
Bioeksperimen: Jurnal Penelitian Biologi Vol 8, No 2: September 2022
Publisher : Universitas Muhammadiyah Surakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.23917/bioeksperimen.v8i2.19111

Abstract

Rice is a staple food for the majority of Asians; nevertheless, black rice has not been commonly consumed among them. The components of the yield will be determined by the allocation of photosynthate on rice and the tall phenotype of black rice, which is a significant contributing factor to lodging. The growth inhibitor paclobutrazol prevents the manufacture of gibberellin, which results in the tall phenotype of black rice. The endogenous cytokinin content is high at the beginning of the grain filling and then rapidly decreases after that. The purpose of the study was to compare the effects of paclobutrazol and cytokinin on culm height, internode length, culm diameter, lodging resistance, culm parenchyma cell arrangement, and flag leaf structure. Throughout the inquiry, Cempo Ireng black rice cultivar seeds were employed. The seeds were planted in plastic containers that held 10 kg of soil for growth medium and organic fertilizer, and a random block pattern was used for the experiment's design. At 10 weeks following sowing, paclobutrazol was sprayed as a foliar application at concentrations of 0, 50, and 100 ppm. By injecting the kinetin diluted in 0.8 percent agar gel at a rate of 10-5 M in the flag leaf internode lacuna twice, separated by two days, two weeks after anthesis. Eight replications and six combinations were made. DMRT and the significant different were used in the statistical analysis of the mean comparisons (P=0.05). Plant height and internode length were decreased by paclobutrazol (100 ppm), although internode diameter was raised and lodging resistance was induced. The organization of the parenchyma cells in the culm (100 ppm packlobutrazol) changed, and the cells were small and lacked intercellular gaps.
IMPLEMENTASI DASAR PEMBELAJARAN DAN KONSEP EVALUASI SUMATIF Ina Magdalena; Sabila Putri Andriani; Kumala Dewi; Irma Agustin
Sindoro: Cendikia Pendidikan Vol. 2 No. 11 (2024): Sindoro: Cendikia Pendidikan
Publisher : Cahaya Ilmu Bangsa Institute

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.9644/sindoro.v2i11.1987

Abstract

Penilaian pembelajaran adalah proses mengukur dan menilai kemajuan hasil belajar siswa. Prinsip kesinambungan adalah dasar dari evaluasi, dan evaluasi yang didasarkan pada prinsip ini dianggap sebagai evaluasi yang baik jika penilai dapat membuat kesimpulan yang tepat tentang perkembangan hasil belajar siswa. Sangat penting untuk mengevaluasi tingkat partisipasi siswa dalam kegiatan kelompok dan pembelajaran individu. Guru harus memperhatikan fakta bahwa siswa biasanya datang ke kelas dengan berbagai tingkat kemampuan. Sebagian besar siswa memahami materi dengan cepat. namun, ada beberapa siswa yang belajar lebih lambat daripada yang biasanya.
PENERAPAN AKUNTANSI KEPERILAKUAN PADA PT. HADJI KALLA TOYOTA PINRANG (ANALISIS AKUNTANSI SYARIAH) Kumala Dewi
Funds: Jurnal Ilmiah Akuntansi, Keuangan, dan Bisnis Vol 3 No 1 (2024)
Publisher : Program Studi Akuntansi Lembaga Keuangan Syariah, FEBI, IAIN Parepare

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35905/.v3i1.10955

Abstract

Behavioral accounting can help identify and prevent accounting fraud in companies and improve the quality of company information disclosure. The purpose of behavioral accounting is to understand human behavior in the context of accounting and finance, and to provide an understanding of how financial decisions are made. The research method used by the writer is qualitative research. Qualitative research is research that uses the background of nature, with the intention of interpreting the phenomenon that occurs and is carried out by involving various existing methods. Based on the research results obtained about the application of behavioral accounting at PT. Hadji Kalla Toyota Pinrang, Behavioral Accounting provides convenience for companies in determining steps based on existing financial reports that have a positive and significant impact on managerial performance. Behavioral accounting provides great benefits for the management of an organization or company in making decisions. Behavioral accounting can facilitate decision-making because behavioral accounting presents data on the behavior and attitude of employees before the company makes a decision so that the company knows whether its employees have reached the target or not, because basically individual attitudes can affect all processes in the company. decision making
SISTEM KOPERASI SIMPAN PINJAM PEGAWAI BERBASIS BERBASIS WEBSITE Sulfikram; Maisyarah, Dwi Cahya; Dwi Sumatri, Bayyinahtun; Friska Amelia; Kumala Dewi; Tenriawaru, Andi; Arviana Rahman, Gusti
Riau Jurnal Teknik Informatika Vol. 4 No. 2 (2025): Juli 2025
Publisher : Prodi Teknik Informatika Universitas Pasir Pengaraian

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30606/rjti.v4i2.3449

Abstract

Koperasi simpan pinjam merupakan institusi keuangan yang memainkan peran penting dalam memberikan layanan keuangan kepada anggotanya, khususnya dalam bentuk simpanan dan pinjaman. Akan tetapi, pengelolaan yang dilakukan secara manual sering kali menyebabkan masalah seperti kesalahan dalam pencatatan, keterlambatan dalam laporan, dan kesulitan dalam mengakses informasi oleh anggota. Penelitian ini bertujuan untuk merancang dan mengembangkan sistem informasi koperasi simpan pinjam yang berbasis website di Badan Pusat Statistik (BPS) Provinsi Sulawesi Tenggara. Sistem ini dirancang dengan metode Waterfall yang meliputi tahap analisis kebutuhan, desain, implementasi, pengujian, dan pemeliharaan. Dalam proses perancangan, digunakan framework Laravel dan database MySQL. Pengujian fitur dilakukan menggunakan metode Black Box Testing untuk memastikan bahwa semua fitur berjalan sesuai dengan fungsinya. Hasil menunjukkan bahwa sistem dapat mengelola pencatatan data anggota, transaksi pinjaman, serta penyusunan laporan keuangan secara akurat dan tepat waktu. Sistem ini juga mampu meningkatkan efisiensi kerja pengurus koperasi dan memberikan akses informasi yang lebih jelas bagi anggota
Analisis Strategi Guru dalam Menanamkan Nilai Pendidikan Karakter pada Anak Sekolah Dasar Yeni Nuraeni; Amanda Putri Humaeroh; Chiqa Arnabila Zahraan; Kumala Dewi; Rahma Izzatul Janah; Risma Odis Adellia
Jurnal Bintang Pendidikan Indonesia Vol. 3 No. 3 (2025): Agustus: Jurnal Bintang Pendidikan Indonesia
Publisher : Pusat Riset dan Inovasi Nasional

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.55606/jubpi.v3i1.3605

Abstract

This study aims to analyze teachers' strategies in instilling character education values in elementary school students based on various studies and references. Character education serves as a crucial foundation in shaping students' morals and attitudes, particularly at the elementary education level. Various studies reveal that the strategies implemented include role modeling, integrating character values into the learning process, case discussion methods, and reinforcement through constructive rewards or disciplinary actions. Furthermore, collaboration between teachers, parents, and the school environment significantly supports the success of character education implementation. This study provides insights that the success of character education requires a holistic approach involving all stakeholders to create a conducive learning ecosystem for students' character development.
MENELAAH NILAI MORAL DALAM NOVEL HUJAN KARYA TERE LIYE:KAJIAN SASTRA STRUKTUAL Elsy Olivia; Ria; Aisyah Fitri; Kumala Dewi; Saptiana Sulastri
Pendas : Jurnal Ilmiah Pendidikan Dasar Vol. 11 No. 02 (2026): Volume 11 Nomor 02, Juni 2026 Published
Publisher : Program Studi Pendidikan Guru Sekolah Dasar FKIP Universitas Pasundan

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.23969/jp.v11i02.46245

Abstract

The novel Hujan by Tere Liye not only presents an engaging story about love, loss, and environmental change, but also contains various profound moral values. This study employs a structural literary approach to analyze the relationship between the intrinsic elements of the novel and the moral values contained within it. The purpose of this research is to describe the intrinsic elements of the novel Hujan and to identify the moral values conveyed by the author through the story. The method used is descriptive-analytical with data collection techniques in the form of literature study, intensive reading, note-taking, and data classification. The results show that intrinsic elements such as theme, characters and characterization, plot, setting, point of view, and language style work synergistically to construct the moral messages in the novel. The moral values found include perseverance, empathy, sacrifice, faith, responsibility, and environmental awareness. This study confirms that the novel Hujan functions not only as entertainment, but also as a medium for moral learning for readers.
Co-Authors A. Adi Prawoto Aisyah Fitri Amanda Putri Humaeroh Ari Indrianto Arviana Rahman, Gusti Chiqa Arnabila Zahraan Darussalam Darussalam Diah Rachmawati Dwi Sumatri, Bayyinahtun Elsy Olivia Endang Sutariningsih Friska Amelia Ina Magdalena Irma Agustin Maisyarah, Dwi Cahya Nurwijayanti R. Refli Rahma Izzatul Janah Ria Risma Odis Adellia Sabila Putri Andriani Santosa Santosa Saptiana Sulastri, Saptiana Sukarti Muljopawiro Sulfikram Wijanarka Wijanarka Yeni Nuraeni Yohana Theresia Astuti