cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kab. sleman,
Daerah istimewa yogyakarta
INDONESIA
Indonesian Journal of Biotechnology
Published by Universitas Gadjah Mada
ISSN : 08538654     EISSN : 20892241     DOI : -
Core Subject : Science,
Biochemistry, Genetics & Molecular Biology Immunology & microbiology Materials Science & Nanotechnology
The Indonesian Journal of Biotechnology (IJBiotech) is an open access, peer-reviewed, multidisciplinary journal dedicated to the publication of novel research in all aspects of biotechnology, with particular attention paid to the exploration and development of natural products derived from tropical—and especially Indonesian—biodiversity. IJBiotech is published biannually and accepts original research articles featuring well-designed studies with clearly analyzed and logically interpreted results. A strong preference is given to research that has the potential to make significant contributions to both the field of biotechnology and society in general.
Arjuna Subject : -
Articles 12 Documents
 1   2 
Search results for , issue "Vol 11, No 2 (2006)" : 12 Documents clear
Molecular Study on The Pathogenicity of Avian Influenza Virus Haryadi M. Wibowo; Heru Susetya; Tri Untari; Khrisdiana Putri; Charles Rangga Tabbu
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB) | DOI: 10.22146/ijbiotech.7567

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.
Reactive Oxygen Intermediate (ROI) in Dog Macrophage Infected with Mycobacterium tuberculosis Ida Tjahajati
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (151.109 KB) | DOI: 10.22146/ijbiotech.7568

Abstract

experiment used 24 healthy dogs, aged between 1 and 2 years, both male and female which were divided into twodifferent groups consisting of 12 dogs each. The first group was the treatment group, that is they were infected with Mtuberculosis and the second one was the control group. The activity of macrophages ROI secretion were measured at1st, 2nd, 12th, and 24th after infection using nitroblue tetrazolium (NBT) reduction assay. Three cats were used to measure themacrophage activity in each period, using triplicate sample for each cat. The results of the experiment showed thatROI secretion increased in infected group compared with the control group, and this activity reached to the plateaulevel at 2 weeks after infection. Although these enhanced activities were gradually diminished thereafter, higherlevels of these activities were consistently observed until the end of experiment compared with control group. Theresults of the experiment indicated that ROI played an important role to against M.tuberculosis infection in dogs.Keyword: macrophage, ROI, M.tuberculosis, dogs

Page 2 of 2 | Total Record : 12

 1   2 

Filter by Year

2006 2006


Reset
Filter By Issues
All Issue Vol 30, No 4 (2025) Vol 30, No 3 (2025) Vol 30, No 2 (2025) Vol 30, No 1 (2025) Vol 29, No 4 (2024) Vol 29, No 3 (2024) Vol 29, No 2 (2024) Vol 29, No 1 (2024) Vol 28, No 4 (2023) Vol 28, No 3 (2023) Vol 28, No 2 (2023) Vol 28, No 1 (2023) Vol 27, No 4 (2022) Vol 27, No 3 (2022) Vol 27, No 2 (2022) Vol 27, No 1 (2022) Vol 26, No 4 (2021) Vol 26, No 3 (2021) Vol 26, No 2 (2021) Vol 26, No 1 (2021) Vol 25, No 2 (2020) Vol 25, No 1 (2020) Vol 24, No 2 (2019) Vol 24, No 1 (2019) Vol 23, No 2 (2018) Vol 23, No 1 (2018) Vol 22, No 2 (2017) Vol 22, No 1 (2017) Vol 21, No 2 (2016) Vol 21, No 1 (2016) Vol 20, No 2 (2015) Vol 20, No 1 (2015) Vol 19, No 2 (2014) Vol 19, No 1 (2014) Vol 19, No 1 (2014) Vol 18, No 2 (2013) Vol 18, No 2 (2013) Vol 18, No 1 (2013) Vol 18, No 1 (2013) Vol 17, No 2 (2012) Vol 17, No 2 (2012) Vol 17, No 1 (2012) Vol 17, No 1 (2012) Vol 16, No 2 (2011) Vol 16, No 2 (2011) Vol 16, No 1 (2011) Vol 16, No 1 (2011) Vol 15, No 2 (2010) Vol 15, No 2 (2010) Vol 15, No 1 (2010) Vol 15, No 1 (2010) Vol 14, No 2 (2009) Vol 14, No 2 (2009) Vol 14, No 1 (2009) Vol 14, No 1 (2009) Vol 13, No 2 (2008) Vol 13, No 2 (2008) Vol 13, No 1 (2008) Vol 13, No 1 (2008) Vol 12, No 2 (2007) Vol 12, No 2 (2007) Vol 12, No 1 (2007) Vol 12, No 1 (2007) Vol 11, No 2 (2006) Vol 11, No 2 (2006) Vol 11, No 1 (2006) Vol 11, No 1 (2006) Vol 10, No 2 (2005) Vol 10, No 2 (2005) Vol 10, No 1 (2005) Vol 10, No 1 (2005) More Issue