Article Per Year (5 Year)
p-Index From 2021 - 2026
0
P-Index
This Author published in this journals
All Journal Hemera Zoa Jurnal Sain Veteriner Indonesian Journal of Biotechnology
Charles Rangga Tabbu
Unknown Affiliation
Biochemistry, Genetics & Molecular Biology Immunology & microbiology Materials Science & Nanotechnology Veterinary

Published : 6 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 6 Documents
Search

 1 
MP-16 Characterization of Avibacterium paragallinarum Caused Infectious coryza/Snot: Satellite Colony Phenomenon Agnesia Endang Tri hastuti Wahyuni; Charles Rangga Tabbu; Sidna Artanto; Tati Aryani; Vinsa Cantya Prakasita
Hemera Zoa Proceedings of the 20th FAVA & the 15th KIVNAS PDHI 2018
Publisher : Hemera Zoa

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (587.497 KB)

Abstract

Infectious coryza (IC) is an acute upper respiratory disease of poultry that can appear in all ages. Some of clinical signs that are commonly seen in IC are rhinitis, facial swelling or edema, lacrimation, anorexia, and retarded growth in young poultry [1.2.3]. The disease can be found worldwide, especially in tropical countries [4]. Infectious coryza is very important in the chicken farm industry in developed and developing countries, including Indonesia [5]. The large economic losses due to IC such as increased number of culling, decreased egg production (10-40%), decreased body weight, stunting growth, and some mortality (2-10%) [4].Avibacterium paragallinarum which was previously classified as Haemophilus paragallinarum is a causative agent of infectious coryza in laying and broiler chickens, quail, pearl chicken, turkey, and peacocks [4,6,7,8]. The bacteria is commensal in the mucous membrane of the upper respiratory system, is sensitive to preservation and does not last long outside the host body [8]. Factors X and V are needed for the growth of several types of A. paragallinarum. According to in vitro growth requirements, A. paragallinarum can be either nicotinamide adenine dinucleotide (NAD) independent or NAD-dependent. The reduced form of NAD (NADH; 1.56-25 µg/ml) and the oxidized form (20-100 µg/ml) is required for in vitro growth in most isolates A. paragallinarum that show satellitic colony on a medium [9]. The description of the need for V factor of field isolates A. paragalinarum has been few reported. The aim of this research is to find out the phenomenon of satellite colonies from a variety of poultry isolates.
Molecular Study on The Pathogenicity of Avian Influenza Virus Haryadi M. Wibowo; Heru Susetya; Tri Untari; Khrisdiana Putri; Charles Rangga Tabbu
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB) | DOI: 10.22146/ijbiotech.7567

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.
The Development of Pathogenicity of Avian Influenza Virus Isolated from Indonesia Michael Haryadi Wibowo; Agus Eko Srihanto; Khrisdiana Putri; Widya Asmara; Charles Rangga Tabbu
Indonesian Journal of Biotechnology Vol 18, No 2 (2013)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (202.434 KB) | DOI: 10.22146/ijbiotech.7876

Abstract

Highly pathogenic avian infl uenza outbreak in Indonesia has been reported in various poultry due toH5N1 subtype. The presence of multiple basic amino acids within the cleavage site of HA glycoprotein hasbeen identifi ed to be associated with the pathogenicity of avian infl uenza virus. The study was retrospectivestudy which was designed to characterize the cleavage site and fusion site region of haemagglutinin gene ofAIV isolated from various poultry in 2003 to 2013. Isolation, Identifi cation and propagation were carried outto collect viral stock. For virus detection, reverse transcriptase PCR (RT-PCR) method on H5 and N1 genefragment was performed. All of RT-PCR HA gene positive products were sequenced for further nucleotideanalysis and to determine the nucleotide composition at the targeted fragment. The results are all AIV isolateswere identifi ed as H5N1 subtype. The sequence analyses revealed some motives of basic amino acid motivethat were classifi ed as highly pathogenic avian infl uenza virus. Further analyses on fusion domain of all AIVisolated during the period 2003 to 2013 showed conserved amino acid. Keywords: avian infl uenza, haemagglutinin, cleavage site, basic amino acid, fusion site
Kajian Kasus-kontrol Avian Influenza Pada Unggas di Jawa Timur, Jawa Tengah dan Daerah Istimewa Yogyakarta= A Case-control Study on Avian Influenza in Poultry in East Java, Central Java and Yogyakarta Special Province. Dyah Ayu Widiasih; Heru Susetyo; Bambang Sumiarto; Charles Rangga Tabbu; Setyawan Budiharta
Jurnal Sain Veteriner Vol 24, No 1 (2006): JUNI
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1791.726 KB) | DOI: 10.22146/jsv.341

Abstract

Kajian kasus-kontrol yang dirancang untuk menyidik kejadian avian influenza (Al) dan mencari hubungannya dengan faktor resiko penyakit, telah dilakukan terhadap 218 dusun di Jawa Timur, Jawa Tengah dan Daerah Istimewa Yogyakarta. Sebagai kasus (109 dusun) adalah dusun yang pernah dilaporkan atau sedang mengalami kasus AI, dan kontrol (109 dusun), adalah dusun yang dilaporkan belum pernah mengalami, tetapi dekat dengan dusun kasus. Kuesioner digunakan untuk menjaring variabel yang diperkirakan berasosiasi dengan kejadian AI. Data yang diperoleh dianalisis dengan Chi Square (x2) dan odds ratio (OR). Hasil kajian menunjukkan bahwa faktor adanya hewan pengerat (OR = 1,90), faktor adanya burung liar (OR = 24,00), faktor pekerja pulang sehabis kerja (OR = 2,65), dan faktor sektor III (OR = 1,79) mempunyai asosiasi karat dengan kejadian AI di suatu dusun, sedangkan beberapa faktor biosekuriti berasosiasi lemah (OR = 1,0 – 1,5) terhadap kejadian Al.
Isolasi dan Identifiicasi Serologis Virus Avian Influenza Dari Sampel Unggas Yang Diperoleh di D.I. Yogyakarta dan Jawa Tengah = Isolation and Serological Identification of Avian Influenza Virus From Poultry Sample ... Michael Haryadi Wibowo; Widya Asmara; Charles Rangga Tabbu
Jurnal Sain Veteriner Vol 24, No 1 (2006): JUNI
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3152.733 KB) | DOI: 10.22146/jsv.346

Abstract

Avian Influenza (AI) merupakan penyakit penting pada unggas, karena dapat menyebabkan kerugian ekonomi secara signifikan, dengan tingkat morbiditas dan mortalitas penyakit sangat tinggi. L,ebih dan itu potensi penularan penyakit AI dari hewan ke manusia, memberikan dampak ekonomi tersendiri. Beberapa kasus yang diduga sebagai AI banyak mewabah di beberapa daerah di Indonesia. Penyakit tersebut cukup membingungkan peternak dan sangat dikacaukan dengan penyakit Newcastle (ND) karena kedua penyakit mempunyai kemiripan karakter dan gejala klinis. Penelitian ini bertujuan untuk mengkonfirmasi apakah wabah penyakit tersebut disebabkan oleh virus AI atau virus ND. Sampel isolasi diambil dari paru atau trakhea, kemudian diproses lebih lanjut untuk diisolasi, dipropagasi secara in ovo menggunakan telur ayam berembrio umur 9 sampai 12 hari, spesific pathogen free atau telur yang setidaknya bebas antibodi terhadap virus AI. Teknik isolasi menurut standar prosedur Office International des Epizooties (01E) dan kemungkinan adanya pertumbuhan virus diuji terhadap kemampuan mengaglutinasi sel darah merah ayam atau hemaglutinasi (HA). Uji HA positif, mengindikasikan ada pertumbuhan virus ND atau virus AL Kedua jenis virus tersebut dapat dibedakan dengan uji hemaglutinasi inhibisi (HI) menggunakan serum anti dari masing-masing virus yang diuji. Berdasarkan hasil penelitian ini dapat diambil suatu kesimpulan bahwa beberapa sampel unggas, yaitu: ayam petelur, ayam broiler, ayam kampung, dan burung puyuh, yang di peroleh dari beberapa daerah di D.I. Yogyakarta dan Jawa Tengah dan secara klinis menunjukkan gejala tersifat maupun tidak tersifat AI, secara serologis dapat dikonfirmasi sebagai virus avian influenza sub-tipe 145Ni.
Identifikasi Subtipe Hemaglutinin Virus Avian Influenza Pada Berbagai Spesies Unggas dengan RT-PCR Widya Asmara; M. Haryadi Wibowo; Charles Rangga Tabbu
Jurnal Sain Veteriner Vol 23, No 1 (2005): JUNI
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1809.212 KB) | DOI: 10.22146/jsv.365

Abstract

Wabah avian influenza yang high pathogenic telah terjadi di beberapa wilayah di Indonesia. Infeksi virus ini menimbulkan penyakit respirasi dengan mortalitas yang tinggi pada berbagai spesies unggas, termasuk itik, ayam dan puyuh. Isolasi virus Al dari sampel itik, ayam kampung, petelur dan pedaging telah berhasil dilakukan di Laboratorium Mikrobiologi Fakultas Kedokteran Hew an Universitas Gadjah Mada, menggunakan telur ayam berembrio. Subtipe hemaglutinin virus diidentifikasi dengan RT-PCR menggunakan primer spesifik H5 dan H7. Hasil penelitian memberi indikasi bahwa virus AI yang terisolasi tersebut termasuk dalam subtipe H5.
Co-Authors Agnesia Endang Tri Hastuti Wahyuni Agus Eko Srihanto Aris Haryanto Aris Purwantoro Asmarani Kusumawati Bambang Sumiarto Bambang Sutrisno Dini Wahyu Yudianingtyas Djohan - Djohan . Dyah Ayu Widiasih Enny Yusuf Wachidah Yuniwarti Gusti Ayu Yuniati Kencana Haryadi M. Wibowo Heru Susetya Heru Susetyo I Gusti Ngurah Kade Mahardika Khrisdiana Putri Kurniasih . M. Haryadi Wibowo Medania Purwaningrum Michael Haryadi Wibowo Ratna Ermawati Rini Widayanti Setyawan Budiharta Sidna Artanto Sitarina Widyarini Tati Aryani Tri Untari Vinsa Cantya Prakasita Wayan Tunas Artama Widya Asmara Yuli Purwandari Kristiangingrum Yuriadi -