Article Per Year (5 Year)
p-Index From 2020 - 2025
0
P-Index
This Author published in this journals
All Journal Hemera Zoa Jurnal Sain Veteriner Jurnal Veteriner Indonesian Journal of Biotechnology
Charles Rangga Tabbu
Unknown Affiliation
Biochemistry, Genetics & Molecular Biology Immunology & microbiology Materials Science & Nanotechnology Veterinary

Published : 16 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 16 Documents
Search

 1   2 
MP-16 Characterization of Avibacterium paragallinarum Caused Infectious coryza/Snot: Satellite Colony Phenomenon Agnesia Endang Tri hastuti Wahyuni; Charles Rangga Tabbu; Sidna Artanto; Tati Aryani; Vinsa Cantya Prakasita
Hemera Zoa Proceedings of the 20th FAVA & the 15th KIVNAS PDHI 2018
Publisher : Hemera Zoa

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (587.497 KB)

Abstract

Infectious coryza (IC) is an acute upper respiratory disease of poultry that can appear in all ages. Some of clinical signs that are commonly seen in IC are rhinitis, facial swelling or edema, lacrimation, anorexia, and retarded growth in young poultry [1.2.3]. The disease can be found worldwide, especially in tropical countries [4]. Infectious coryza is very important in the chicken farm industry in developed and developing countries, including Indonesia [5]. The large economic losses due to IC such as increased number of culling, decreased egg production (10-40%), decreased body weight, stunting growth, and some mortality (2-10%) [4].Avibacterium paragallinarum which was previously classified as Haemophilus paragallinarum is a causative agent of infectious coryza in laying and broiler chickens, quail, pearl chicken, turkey, and peacocks [4,6,7,8]. The bacteria is commensal in the mucous membrane of the upper respiratory system, is sensitive to preservation and does not last long outside the host body [8]. Factors X and V are needed for the growth of several types of A. paragallinarum. According to in vitro growth requirements, A. paragallinarum can be either nicotinamide adenine dinucleotide (NAD) independent or NAD-dependent. The reduced form of NAD (NADH; 1.56-25 µg/ml) and the oxidized form (20-100 µg/ml) is required for in vitro growth in most isolates A. paragallinarum that show satellitic colony on a medium [9]. The description of the need for V factor of field isolates A. paragalinarum has been few reported. The aim of this research is to find out the phenomenon of satellite colonies from a variety of poultry isolates.
Molecular Study on The Pathogenicity of Avian Influenza Virus Haryadi M. Wibowo; Heru Susetya; Tri Untari; Khrisdiana Putri; Charles Rangga Tabbu
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB) | DOI: 10.22146/ijbiotech.7567

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.
The Development of Pathogenicity of Avian Influenza Virus Isolated from Indonesia Michael Haryadi Wibowo; Agus Eko Srihanto; Khrisdiana Putri; Widya Asmara; Charles Rangga Tabbu
Indonesian Journal of Biotechnology Vol 18, No 2 (2013)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (202.434 KB) | DOI: 10.22146/ijbiotech.7876

Abstract

Highly pathogenic avian infl uenza outbreak in Indonesia has been reported in various poultry due toH5N1 subtype. The presence of multiple basic amino acids within the cleavage site of HA glycoprotein hasbeen identifi ed to be associated with the pathogenicity of avian infl uenza virus. The study was retrospectivestudy which was designed to characterize the cleavage site and fusion site region of haemagglutinin gene ofAIV isolated from various poultry in 2003 to 2013. Isolation, Identifi cation and propagation were carried outto collect viral stock. For virus detection, reverse transcriptase PCR (RT-PCR) method on H5 and N1 genefragment was performed. All of RT-PCR HA gene positive products were sequenced for further nucleotideanalysis and to determine the nucleotide composition at the targeted fragment. The results are all AIV isolateswere identifi ed as H5N1 subtype. The sequence analyses revealed some motives of basic amino acid motivethat were classifi ed as highly pathogenic avian infl uenza virus. Further analyses on fusion domain of all AIVisolated during the period 2003 to 2013 showed conserved amino acid. Keywords: avian infl uenza, haemagglutinin, cleavage site, basic amino acid, fusion site
Kajian Kasus-kontrol Avian Influenza Pada Unggas di Jawa Timur, Jawa Tengah dan Daerah Istimewa Yogyakarta= A Case-control Study on Avian Influenza in Poultry in East Java, Central Java and Yogyakarta Special Province. Dyah Ayu Widiasih; Heru Susetyo; Bambang Sumiarto; Charles Rangga Tabbu; Setyawan Budiharta
Jurnal Sain Veteriner Vol 24, No 1 (2006): JUNI
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1791.726 KB) | DOI: 10.22146/jsv.341

Abstract

Kajian kasus-kontrol yang dirancang untuk menyidik kejadian avian influenza (Al) dan mencari hubungannya dengan faktor resiko penyakit, telah dilakukan terhadap 218 dusun di Jawa Timur, Jawa Tengah dan Daerah Istimewa Yogyakarta. Sebagai kasus (109 dusun) adalah dusun yang pernah dilaporkan atau sedang mengalami kasus AI, dan kontrol (109 dusun), adalah dusun yang dilaporkan belum pernah mengalami, tetapi dekat dengan dusun kasus. Kuesioner digunakan untuk menjaring variabel yang diperkirakan berasosiasi dengan kejadian AI. Data yang diperoleh dianalisis dengan Chi Square (x2) dan odds ratio (OR). Hasil kajian menunjukkan bahwa faktor adanya hewan pengerat (OR = 1,90), faktor adanya burung liar (OR = 24,00), faktor pekerja pulang sehabis kerja (OR = 2,65), dan faktor sektor III (OR = 1,79) mempunyai asosiasi karat dengan kejadian AI di suatu dusun, sedangkan beberapa faktor biosekuriti berasosiasi lemah (OR = 1,0 – 1,5) terhadap kejadian Al.
Isolasi dan Identifiicasi Serologis Virus Avian Influenza Dari Sampel Unggas Yang Diperoleh di D.I. Yogyakarta dan Jawa Tengah = Isolation and Serological Identification of Avian Influenza Virus From Poultry Sample ... Michael Haryadi Wibowo; Widya Asmara; Charles Rangga Tabbu
Jurnal Sain Veteriner Vol 24, No 1 (2006): JUNI
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3152.733 KB) | DOI: 10.22146/jsv.346

Abstract

Avian Influenza (AI) merupakan penyakit penting pada unggas, karena dapat menyebabkan kerugian ekonomi secara signifikan, dengan tingkat morbiditas dan mortalitas penyakit sangat tinggi. L,ebih dan itu potensi penularan penyakit AI dari hewan ke manusia, memberikan dampak ekonomi tersendiri. Beberapa kasus yang diduga sebagai AI banyak mewabah di beberapa daerah di Indonesia. Penyakit tersebut cukup membingungkan peternak dan sangat dikacaukan dengan penyakit Newcastle (ND) karena kedua penyakit mempunyai kemiripan karakter dan gejala klinis. Penelitian ini bertujuan untuk mengkonfirmasi apakah wabah penyakit tersebut disebabkan oleh virus AI atau virus ND. Sampel isolasi diambil dari paru atau trakhea, kemudian diproses lebih lanjut untuk diisolasi, dipropagasi secara in ovo menggunakan telur ayam berembrio umur 9 sampai 12 hari, spesific pathogen free atau telur yang setidaknya bebas antibodi terhadap virus AI. Teknik isolasi menurut standar prosedur Office International des Epizooties (01E) dan kemungkinan adanya pertumbuhan virus diuji terhadap kemampuan mengaglutinasi sel darah merah ayam atau hemaglutinasi (HA). Uji HA positif, mengindikasikan ada pertumbuhan virus ND atau virus AL Kedua jenis virus tersebut dapat dibedakan dengan uji hemaglutinasi inhibisi (HI) menggunakan serum anti dari masing-masing virus yang diuji. Berdasarkan hasil penelitian ini dapat diambil suatu kesimpulan bahwa beberapa sampel unggas, yaitu: ayam petelur, ayam broiler, ayam kampung, dan burung puyuh, yang di peroleh dari beberapa daerah di D.I. Yogyakarta dan Jawa Tengah dan secara klinis menunjukkan gejala tersifat maupun tidak tersifat AI, secara serologis dapat dikonfirmasi sebagai virus avian influenza sub-tipe 145Ni.
Identifikasi Subtipe Hemaglutinin Virus Avian Influenza Pada Berbagai Spesies Unggas dengan RT-PCR Widya Asmara; M. Haryadi Wibowo; Charles Rangga Tabbu
Jurnal Sain Veteriner Vol 23, No 1 (2005): JUNI
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1809.212 KB) | DOI: 10.22146/jsv.365

Abstract

Wabah avian influenza yang high pathogenic telah terjadi di beberapa wilayah di Indonesia. Infeksi virus ini menimbulkan penyakit respirasi dengan mortalitas yang tinggi pada berbagai spesies unggas, termasuk itik, ayam dan puyuh. Isolasi virus Al dari sampel itik, ayam kampung, petelur dan pedaging telah berhasil dilakukan di Laboratorium Mikrobiologi Fakultas Kedokteran Hew an Universitas Gadjah Mada, menggunakan telur ayam berembrio. Subtipe hemaglutinin virus diidentifikasi dengan RT-PCR menggunakan primer spesifik H5 dan H7. Hasil penelitian memberi indikasi bahwa virus AI yang terisolasi tersebut termasuk dalam subtipe H5.
Tapak Perlekatan Reseptor Virus Flu Burung yang Diisolasi dari Berbagai Unggas Sejak tahun 2003 sampai 2008 (RECEPTOR BINDING SITE OF AVIAN INFLUENZA VIRUS H5N1 ISOLATED FROM VARIOUS POULTRIES SINCE 2003 TO 2008) Michael Haryadi Wibowo; Charles Rangga Tabbu; Widya Asmara; Heru Susetya
Jurnal Veteriner Vol 13 No 2 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (202.498 KB)

Abstract

Avian Influenza (AI) is an infectious disease in poultry, caused by type A of avian influenza virus(AIV), in the family of Orthomyxoviridae. Almost all birds’ species are sensitive to the AI. Beside theability to infect various species of poultry. AIV type A has a wide range of host including all bird species,mammals, dan human. Today some scientists reported that the cases of AI in mammals, including humansare increasing. This condition suggests that the AI virus circulated in the field may have some mutationsin the amino acid determinants responsible receptor binding site (RBS). A research was therefore designedto investigate the molecular level of HA gen fragment responsible for receptor binding site of AIV isolatedfrom various poultry since 2003 to 2008. Molecular characterization was based on the amplification ofreceptor binding site of HA gene by reverse transcriptase polymerase chain reaction (RT-PCR). All RTPCRof HA gene positive products were sequenced to determine the nucleotide composition at the targetedfragment. Sequences yielded were analyzed by program Mega 4.0 versions, including multiple alignment,deductive amino acid prediction, and establishment of phylogenetic tree. The results show that all AIVisolates could be determined of some conserved amino acids residues responsible for RBS which indicatethe binding preference of avian like receptor, sialic acid ? 2, 3 galactose except isolate A/Layer/Jabar/MHW-RBS-02/2008 which could be found a deletion of amino acid at position of 129 dan mutation of 151isoleucine into threonine. Phylogenetic study showed that clustering of AIV did not base on species of birdor geographic origin of AI viruses which were studied.
Kajian Molekuler Daerah D-Loop Parsial DNA Mitokondria Kuda (Equus caballus) Asli Tengger Yuriadi -; Rini Widayanti; Aris Purwantoro; Charles Rangga Tabbu
Jurnal Veteriner Vol 11 No 1 (2010)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (183.707 KB)

Abstract

Tengger’s horse (Equus caballus) is a local Indonesian horse an originated from its ancestor in Java.As the population of Tengger’s horse is almost extinct it is important to conserve and increase the horsepopulation by in situ or ex situ conservation.The objective of this research was to study the moleculargenetic of partial D-loop of Tengger’s horse. Sequencing of PCR product, showed that the D-loop consistedof 319 nucleotides. The DNA was isolated from whole blood and amplified and sequenced using a publishedprimer sets. The sequence was aligned and compared with horse D-loop sequences available in Genebankusing Clustal W method in MEGA program version 4.0.2. Ten different nucleotide sites were found inTengger horse from (nucleotide no. 9, 52, 64, 69, 102, 117, 133, 170, 187 and 293). The genetic distanceanalised using Kimura 2-parameter model ranged between 0,0% and 3,2%, with the average of 1,7%. Thephylogenetic tree using neighbor joining method based on the sequence of nucleotide partial D-loop couldnot be used to differentiate among horse from Tengger and E. caballus.
AMINO-TERMINUS OF POLYMERASE BASIC-2 OF AVIAN INFLUENZA VIRUS OF H5N1 SUBTYPE ISOLATED FROM VARIOUS ANIMAL SPECIES IN INDONESIA Gusti Ayu Yuniati Kencana; Widya Asmara; Charles Rangga Tabbu; I Gusti Ngurah Kade Mahardika
Jurnal Veteriner Vol 9 No 3 (2008)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (827.692 KB)

Abstract

The information on pathogenicity and adaptation factors of avian influenza virus (AIV) in mammalsis very inportant in an effort to reduce the risk of avian influenza (AI) pandemic in the future. Polymerasegene complex appears to be the major factors for adaptation of AIV to certain animal species. A preliminarystudy on role of non-coding region (NCR) and amino-terminus of polymerase-basic 2 (PB2) is presented.Purified viral RNA of AIV isolated from chicken, duck, pig, and quail of Bali and Yogyakarta was reversetranscribed into cDNA and amplified using reverse transcriptase-polymerase chain reaction (RT-PCR)using PB-2 universal forward primer and specifically designed backward primer. The result showed thatall AIV’s H5N1 isolated from chicken, duck, quail, and pig, posed PB2 amino-terminus typical for IndonesianAIV H5N1. However, polymorphic amino acids of the protein fragment did not show any species specificmotive, with the exception of the pig isolate Sw/Tabanan/2006 which had specific substitution of D16E,H17Q, M40I, and H124Y.
Virgin Coconut Oil Meningkatkan Aktivitas Fagositosis Makrofag Ayam Pedaging Pascavaksinasi Flu Burung (VIRGIN COCONUT OIL INCREASES THE PHAGOCYTOSIS ACTIVITY OF MACROPHAGE OF BROILER CHICKEN FOLLOWING AVIAN INFLUENZA VACCINATION) Enny Yusuf Wachidah Yuniwarti; Widya Asmara; Wayan Tunas Artama; Charles Rangga Tabbu
Jurnal Veteriner Vol 14 No 2 (2013)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (135.108 KB)

Abstract

The research objective was to find an alternative avian influenza prevention in broilers by increasinganimal’s antibody titer and macrophages phagocytic  activity.  Virgin coconut oil (VCO) is a food supplementthat is proven safe for human consumption therefore it is assumed to be safe for the animal’s (chickens).Factorial design  2 vaccinated: unvaccinated) x 4 (dose of VCO: 0, 5, 10 and 15 mL/kg feed) were applied inthis study.  A total of 40 day day old chick were allocated in the eight treatments groups.  Feed and drinkingwater were available  ad libitum.  Antibody titers of the animals were detected using ELISA, whereasphagocytic activity of the macrophages were detected from spleen.  The result showed that the highestphagocytic activity and antibody titers were seen in chickens which were given VCO at 10 mL/kg feed.  It isconcluded that the VCO could increased the phagocytic activity of macrophages.
Co-Authors Agnesia Endang Tri Hastuti Wahyuni Agus Eko Srihanto Aris Haryanto Aris Purwantoro Asmarani Kusumawati Bambang Sumiarto Bambang Sutrisno Dini Wahyu Yudianingtyas Djohan - Djohan . Dyah Ayu Widiasih Enny Yusuf Wachidah Yuniwarti Gusti Ayu Yuniati Kencana Haryadi M. Wibowo Heru Susetya Heru Susetyo I Gusti Ngurah Kade Mahardika Khrisdiana Putri Kurniasih . M. Haryadi Wibowo Medania Purwaningrum Michael Haryadi Wibowo Ratna Ermawati Rini Widayanti Setyawan Budiharta Sidna Artanto Sitarina Widyarini Tati Aryani Tri Untari Vinsa Cantya Prakasita Wayan Tunas Artama Widya Asmara Yuli Purwandari Kristiangingrum Yuriadi -