Claim Missing Document
Check
Articles

Found 21 Documents
Search

Genetic Analysis of Glycoprotein Gene of Indonesian Rabies Virus Susetya, Heru; Naoto, Ito; Sugiyama, Makoto; Minamoto, Nobuyuki
Indonesian Journal of Biotechnology Vol 10, No 1 (2005)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (265.632 KB)

Abstract

The amino acid sequences of the Glycoprotein gene (G gene) of field rabies virus SN01-23 from Indonesiawas determined. This isolate showed homology of 93% in the ectodomain of the Glycoprotein gene to that of theRC-HL strain, which is used for production of animal vaccine in Japan. The high identity in the ectodomainbetween this field isolate and strain RC-HL suggest that the rabies animal vaccine used in Japan will be effectivefor rabies street viruses in Indonesia. Result of phylogenetic analysis using the nucleotide sequences of the Ggenes of rabies street viruses showed that SN01-23 from Indonesia is more closely related to a rabies virus fromChina than to viruses from Thailand and Malaysia. This genetic data and historical background suggest thatrabies viruses in China had been transferred to Indonesia through dogs brought by humans migrating from Chinato Indonesia.Keywords : Rabies virus, Glycoprotein gene, Ectodomain, Phylogenetic analysis
Molecular Study on The Pathogenicity of Avian Influenza Virus Wibowo, Haryadi M.; Susetya, Heru; Untari, Tri; Putri, Khrisdiana; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB)

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.
Detection of Antibiotic Residues in Chicken Meat and Eggs from Traditional Markets at Yogyakarta City Using Bioassay Method Dyah Ayu Widiasih; Yatri Drastini; Doddi Yudhabuntara; F. Lintang R. Daru Maya; Prisha Lini Sivalingham; Heru Susetya; Widagdo Sri Nugroho Sri Nugroho; M. Th. Khrisdiana Putri; Roza Azizah Primatika; Bambang Sumiarto
Acta VETERINARIA Indonesiana 2019: Special Issues
Publisher : IPB University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (450.823 KB) | DOI: 10.29244/avi.0.0.1-6

Abstract

Studies on antibiotic residues content in food of animal origin are currently needed to support veterinary public health programs. The present study was described bioassay method for the detection of antibiotic residues in chicken meat and eggs from traditional market at Yogyakarta City. A number of twenty-four chicken meat samples and 24 egg samples were taken from 8 traditional markets in Yogyakarta city. Samples were examined at Centre for Veterinary Wates, Yogyakarta, Indonesia using bioassay method for screening detection of penicillin, aminoglycoside, macrolide and tetracycline residues. This bioassay method using some bacteria, such as Bacillus stearothermophillus, B. cereus, B. subtilis, and Kocuria rizophila. A percentage of the results showed that 8.33% (2/24) samples of chickens tested positively contained the oxytetracycline antibiotic residues. Meanwhile, as much as 75% (18/24) samples of positive eggs contain penicillin antibiotic residues, positive residues of aminoglycoside amounted to 12.5% (3/24) and the positive residues of oxytetracycline also amounted to 12.5% (3/24).
PF-3 Prevalence and Risk Factors of Jembrana Disease, Bengkalis District Riau Province Hani Muhamad Mardani; Dewi Anggreini; Yuli Miswati; Heru Susetya
Hemera Zoa Proceedings of the 20th FAVA & the 15th KIVNAS PDHI 2018
Publisher : Hemera Zoa

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (465.783 KB)

Abstract

Jembrana disease (JD) is contagious viral disesase in Bali cattle, caused by Retrovirus from member of Lentivirus group called by Jembrana disease virus (JDV). Jembrana disease outbreak in Bengkalis district first occured 2013 and until now is endemic. This purpose of study is to determine the prevalence of JD and to identify a risk factor associated with JD in Bengkalis district.
Genetic Analysis of Glycoprotein Gene of Indonesian Rabies Virus Heru Susetya; Ito Naoto; Makoto Sugiyama; Nobuyuki Minamoto
Indonesian Journal of Biotechnology Vol 10, No 1 (2005)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (265.632 KB) | DOI: 10.22146/ijbiotech.7413

Abstract

The amino acid sequences of the Glycoprotein gene (G gene) of field rabies virus SN01-23 from Indonesia was determined. This isolate showed homology of 93% in the ectodomain of the Glycoprotein gene to that of the RC-HL strain, which is used for production of animal vaccine in Japan. The high identity in the ectodomain between this field isolate and strain RC-HL suggest that the rabies animal vaccine used in Japan will be effective for rabies street viruses in Indonesia. Result of phylogenetic analysis using the nucleotide sequences of the G genes of rabies street viruses showed that SN01-23 from Indonesia is more closely related to a rabies virus from China than to viruses from Thailand and Malaysia. This genetic data and historical background suggest that rabies viruses in China had been transferred to Indonesia through dogs brought by humans migrating from China to Indonesia.
Molecular Study on The Pathogenicity of Avian Influenza Virus Haryadi M. Wibowo; Heru Susetya; Tri Untari; Khrisdiana Putri; Charles Rangga Tabbu
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB) | DOI: 10.22146/ijbiotech.7567

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.
STATUS VAKSINASI RABIES PADA ANJING DI KOTA MAKASSAR RABIES VACCINATION STATUS OF DOGS IN MAKASSAR Sri Utami; Bambang Sumiarto; Heru Susetya
Jurnal Sain Veteriner Vol 26, No 2 (2008): DESEMBER
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3584.959 KB) | DOI: 10.22146/jsv.326

Abstract

Telah dilakukan suatu analisis cakupan vaksinasi rabies pada anjing di kota Makassar. Tujuan penelitian iniadalah untuk mengetahui cakupan vaksinasi anjing bertuan, serta asosiasi antara status vaksinasi dan faktorfaktormanajemen pemeliharaan anjing. Sebanyak 246 sampel anjing dipilih untuk mengetahui status vaksinasirabies. Analisis status vaksinasi dan faktor pemeliharaan anjing dilakukan secara deskriptif. Uji Chi square (c2)dan odds ratio (OR) digunakan mengetahui asosiasi antara faktor-faktor yang diteliti dan status vaksinasi.Hasil penelitian menunjukkan bahwa cakupan vaksinasi pada anjing bertuan di kota Makassar sangat rendah(21 %). Rendahnya cakupan vaksinasi tersebut diperkirakan berhubungan dengan cara pemeliharaan (P=0,002;OR=4,3), tujuan pemeliharaan (P=0,009; OR=2,3), pengetahuan pemilik tentang rabies (P=0,001; OR=3,0),penghasilan di atas Rp 2.000.000,00 (p=0,000; OR=5,0), dan lokasi pemeliharaan urban area (P=O,OOOI; OR=4, 1).Kata kunci: Cakupanvaksinasi, rabies, faktor risiko
Evaluasi kinerja petugas vaksin rabies di Kota Ambon Astri Dwyanti Tagueha; Heru Susetya; Setyawan Budiharta
Jurnal Sain Veteriner Vol 29, No 2 (2011): DESEMBER
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3926.108 KB) | DOI: 10.22146/jsv.39516

Abstract

Study on the evaluation of rabies vaccinator performance and its associated factors on has been conduced.
Evaluasi kinerja petugas vaksin rabies di Kota Ambon Astri Dwyanti Tagueha; Heru Susetya; Setyawan Budiharta
Jurnal Sain Veteriner Vol 29, No 2 (2011): DESEMBER
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3926.108 KB) | DOI: 10.22146/jsv.39517

Abstract

Study on the evaluation of rabies vaccinator performance and its associated factors on has been conduced.
Penilaian Risiko Kualitatif Masuk dan Tersebarnya Rabies pada Anjing ke Kota Sorong Provinsi Papua Barat Muchammad Taufik Kurniawan; Heru Susetya; Bambang Sumiarto
Jurnal Sain Veteriner Vol 36, No 2 (2018): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (13116.929 KB) | DOI: 10.22146/jsv.39538

Abstract

The rabies outbreaks of Indonesia in these two decades tends to spread faster to other islands/regions. Trade trafficking and people's habits of carrying dogs between islands are contributing factor that triggers rabies cases in Provinces previously free of rabies. This study aims to qualitative risk assessment entry and spread of rabies in dogs into Sorong City of West Papua Province. Methods of collecting primary data obtained from expert opinions, questionnaires, interviews, and direct observation in the field. Secondary data is taken through search of scientific publications, surveillance results, unpublished data in the form of reports, and documents from authorized agencies. The results of study showed that release assessment was high, the incidence of rabies in dogs was 52%, and 180 cases of rabies in humans (lyssa) in Sulawesi, Maluku and North Maluku. The exposure assessment was high based on the presence of rabies transmite animal (RTA) traffic from endemic areas, 58% dogs, 38% cats, and 4% apes from Java 68% (Surabaya 50%, Jakarta 18%), Sulawesi 10% (Manado and Bitung), Maluku 14% (Ambon) and North Maluku 8% (Ternate). The consequence assessment is high because there is a single impact that is categorized as nationally significant. The estimated risk of getting into rabies is high. The potential pathways used in RTA traffic to Sorong City is by sea at 89.3% and air at 10.7%. The results of the study concluded that the qualitative risk assessment of entry and spread of rabies in dogs to the Sorong City of West Papua Province was high. All risk assessments have low uncertainty.