Article Per Year (5 Year)
p-Index From 2021 - 2026
0
P-Index
This Author published in this journals
All Journal Jurnal Teknologi Laboratorium Medicra (Journal of Medical Laboratory Science/Technology)
Amin, Hindah Sabrina
Unknown Affiliation
Chemistry Health Professions Public Health Other

Published : 2 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 2 Documents
Search

 1 
Identification of molecular markers for type 2 Diabetes mellitus in Sidoarjo, Indonesia Mushlih, Miftahul; Sari, Fitri Kumala; Amin, Hindah Sabrina; Iknan, Siti Asriani
Jurnal Teknologi Laboratorium Vol 9 No 2 (2020): 2020 (2)
Publisher : POLTEKKES KEMENKES YOGYAKARTA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29238/teknolabjournal.v9i2.235

Abstract

T2DM can be triggered by two collaborating factors, namely genetics and the environment. This study aimed to identify genetic markers that can be used to detect the possibility of a person having T2D using the random amplified polymorphism DNA (RAPD) method. The study was carried out cross-sectional and involved 60 samples consisting of 30 positive T2D samples and 30 negative samples T2D. The primer used for PCR-RAPD was D20 (5'-ACCCGGTCAC-3’). The PCR-RAPD results were then analyzed using the scoring method and analyzed using the non-parametric Chi-Square test (cl: 95%). Among T2D, 576 bp band were confirmed to be markers in the patients.
Identification of the Mitochondrial ND1 Gene Carrier of Diabetes Mellitus Type 2 with Blood Samples: Identifikasi Gen ND1 Mitokondria Pembawa Sifat Diabetes Mellitus Tipe 2 Melalui Sampel Darah Amin, Hindah Sabrina; Mushlih, Miftahul
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 3 No. 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.873

Abstract

Diabetes Mellitus is a condition where there is an increase in blood glucose levels which is characterized by impaired insulin production or the inability of target tissues to respond to insulin. The purpose of this study was to determine the characteristics of the NADH Dehydrogenase 1 gene in the family of Type 2 Diabetes Mellitus patients. The study used a descriptive exploratory method. The sample came from a family of 5 people with T2D in Sidoarjo. Mitochondrial Genotype Analysis using PCR-Primary Sequencing Forward 5'GAGCAGAACCCAACCTCCGAGCAG3 '(nt2826–2849) and Primary Rivers 5'GATTGTTTGGGCTACTGCTCG3' (nt3728 - 3749). Analysis of the 5 samples used obtained 2 samples that can be analyzed with a band length of 690 bp and 84 bp. Based on the results of primary research, the sample used is difficult to get good amplification results. Only one out of five samples can be amplified properly. The variation of the amplified ND1 gene is found at positions T3031C, G3143C, A3252G, C3303T, C3707T.
Co-Authors Iknan, Siti Asriani Miftahul Mushlih Sari, Fitri Kumala