Article Per Year (5 Year)
p-Index From 2020 - 2025
0
P-Index
This Author published in this journals
All Journal Indonesian Journal of Chemistry
Rosyida Azis Rizki
Department of Chemistry, Faculty of Mathematics and Natural Sciences, Universitas Gadjah Mada, Yogyakarta, Jl. Sekip Utara, Yogyakarta
Chemical Engineering, Chemistry & Bioengineering Chemistry

Published : 1 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 1 Documents
Search
Journal : Indonesian Journal of Chemistry

 1 
CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon) Tri Joko Raharjo; Rosyida Azis Rizki; Stalis Norma Ethica; Elly Rustanti; L. Hartanto Nugroho
Indonesian Journal of Chemistry Vol 11, No 3 (2011)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (338.3 KB) | DOI: 10.22146/ijc.21388

Abstract

Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS) encoding gene from melinjo plant (Gnetum gnemon L.) has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3') and GGR2 (5' CTGGATCGCACATCC TGGTG 3') primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Co-Authors Elly Rustanti L. Hartanto Nugroho Stalis Norma Ethica Tri Joko Raharjo