Article Per Year (5 Year)
p-Index From 2020 - 2025
1.116
P-Index
This Author published in this journals
All Journal Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati Indonesian Journal of Cancer Chemoprevention Indonesian Journal of Biotechnology BIO-SITE |BIOLOGI Sains Terapan BIOPROSPEK Indonesian Journal of Chemistry Communications in Science and Technology Biosaintifika: Journal of Biology & Biology Education Berkala Penelitian Hayati Biosaintifika: Journal of Biology & Biology Education Jurnal Ilmiah Ilmu Kesehatan
L. Hartanto Nugroho
Fakultas Biologi Universitas Gadjah Mada, Yogyakarta
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Dentistry Education Engineering Environmental Science Health Professions Immunology & microbiology Materials Science & Nanotechnology Medicine & Pharmacology Veterinary

Published : 14 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 14 Documents
Search

 1   2 
Aktivitas Antiproliferatif Ekstrak Wasbensin Daun Eupatorium riparium Reg. : Studi In Vitro Pada HeLa Cell lin Yhani Chrystomo, Linus; Nugroho, L. Hartanto; Wahyuono, Subagus; Krishar Karim, Aditya; Terada, Kumiko; Nohno, Tsutomu
Biota Biota Volume 18 Nomor 1 Tahun 2013
Publisher : PBI Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (314.37 KB)

Abstract

Eupatorium riparium Reg. adalah tumbuhan obat penting asli dari Mexico dan India Barat, yang masuk ke tanah Jawa sejak tahun 1800. Tumbuhan ini mempunyai catatan sejarah digunakan untuk obat tradisional dalam berbagai kultur budaya bangsa secara luas di seluruh dunia dan biasa digunakan untuk obat hipertensi, gagal jantung, diuretik, antikanker, antifungi, dan penyakit yang disebabkan oleh bakteri. Studi pada HeLa cell line ini dilakukan selama satu bulan. Selanjutnya, studi ini bertujuan meneliti aktivitas antiproliferatif ekstrak wasbensin daun E. riparium terhadap kanker servik manusia Hela cell line. Aktivitas antiproliferatif diuji menggunakan reagen proliferatif sel WST-1 dengan waktu 1, 2, dan 4 jam setelah diinkubasi selama 72 jam pada suhu 37oC dan 5%CO2. Hasil penelitian menunjukkan bahwa ekstrak wasbensin daun E. riparium mempunyai aktivitas proliferatif yang potensial terhadap HeLa cell line dengan nilai IC50 berikut 102.69 𝜇g/ml (1 jam), 198.67 𝜇g/ml (2 jam). Saran selanjutnya, penelitian lanjutan perlu dilakukan untuk mengetahui mekanisme antikanker HeLa cell line.Kata kunci: Eupatorium riparium Reg, antiproliferatif, HeLa, WST-1
Growth Pattern and Copper Accumulation in Callus of Datura metel Nurchayati, Yulita; Santosa, Santosa; Nugroho, Laurentius Hartanto; Indrianto, Ari
Biosaintifika: Journal of Biology & Biology Education Vol 8, No 2 (2016): September 2016
Publisher : Department of Biology, Faculty of Mathematics and Sciences, Semarang State University . Ro

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15294/biosaintifika.v8i2.5177

Abstract

This experiment was aimed to evaluate the copper accumulation using callus culture of Datura metel L. The culture was established from leaves onto MS contained NAA 2.5 mg/L and Kinetin 0.5 mg/L as the control. The exposure of the culture was carried out by 2 copper compounds as treatment, i.e. CuCl2.2H2O and Na2CuEDTA at level concentration 0.; 0.1; 5; 10; 15; and 20 M. The growth pattern of callus in control showed increasing growth rate in 36 days, whereas exponential stage was reached at 12-20th doi*. Whilst, after 10 doi, the treatment showed constant growth pattern. The absorption rate of the culture was increased by the addition of the CuCl2.2H2O at 5 15 M of level concentration but declined at 20M. The maximum rate of accumulation of Cu (0,1519 mg g-1) was obtained at 15 M. Instead, the addition of Na2CuEDTA at 5 20M of level concentration showed the significant increment while the maximum accumulation was obtained at 20M (0,1420 mg g-1). The existence of chelator in copper compound reduced the rate of toxicity while all tolerance index values were between 66,24 and 97,28 %.The results suggested the role of callus of D. metel as that fairly absorbed and accumulated Cu2+. Exposure with CuCl2.2H2O indicated higher accumulation than Na2CuEDTA.How to CiteNurchayati, Y., Santosa, S., Nugroho, L. H., & Indrianto, A. (2016). Growth Pattern and Copper Accumulation in Callus of Datura metel. Biosaintifika: Journal of Biology & Biology Education, 8(2), 135-140.
Aktivitas Antiproliferatif Ekstrak Wasbensin Daun Eupatorium riparium Reg. : Studi In Vitro Pada HeLa Cell lin Yhani Chrystomo, Linus; Nugroho, L. Hartanto; Wahyuono, Subagus; Krishar Karim, Aditya; Terada, Kumiko; Nohno, Tsutomu
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 18, No 1 (2013): February 2013
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (314.37 KB) | DOI: 10.24002/biota.v18i1.260

Abstract

Eupatorium riparium Reg. adalah tumbuhan obat penting asli dari Mexico dan India Barat, yang masuk ke tanah Jawa sejak tahun 1800. Tumbuhan ini mempunyai catatan sejarah digunakan untuk obat tradisional dalam berbagai kultur budaya bangsa secara luas di seluruh dunia dan biasa digunakan untuk obat hipertensi, gagal jantung, diuretik, antikanker, antifungi, dan penyakit yang disebabkan oleh bakteri. Studi pada HeLa cell line ini dilakukan selama satu bulan. Selanjutnya, studi ini bertujuan meneliti aktivitas antiproliferatif ekstrak wasbensin daun E. riparium terhadap kanker servik manusia Hela cell line. Aktivitas antiproliferatif diuji menggunakan reagen proliferatif sel WST-1 dengan waktu 1, 2, dan 4 jam setelah diinkubasi selama 72 jam pada suhu 37oC dan 5%CO2. Hasil penelitian menunjukkan bahwa ekstrak wasbensin daun E. riparium mempunyai aktivitas proliferatif yang potensial terhadap HeLa cell line dengan nilai IC50 berikut 102.69 𝜇g/ml (1 jam), 198.67 𝜇g/ml (2 jam). Saran selanjutnya, penelitian lanjutan perlu dilakukan untuk mengetahui mekanisme antikanker HeLa cell line.Kata kunci: Eupatorium riparium Reg, antiproliferatif, HeLa, WST-1
The effect of methanol extract of soybean seeds (Glycine max L.Merr.) on the histology and immunohistochemical distribution of Cyp19 aromatase in rat testis (Rattus norvegicus L.) Retno Aryani; Sukarti Moeljopawiro; Laurentius Hartanto Nugroho; Pudji Astuti
Indonesian Journal of Biotechnology Vol 20, No 2 (2015)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (839.696 KB) | DOI: 10.22146/ijbiotech.24199

Abstract

Soybean (Glycine max L. Merr.) contains phytoestrogens that have a chemical structure resembling estrogen in the body. They function like estrogen and antiestrogen, affecting the metabolism of sex steroid hormones. This research aimed to determine the effect of the methanol extract of soybean on the histological structure and distribution of immunohistochemical Cyp19 aromatase in rat testis . Twenty males of Wistar rats were divided into 4 groups of 5. The frst group was the control and the second to fourth groups were given soybean extract (250 mg/kg of body weight, 500 mg/kg of body weight) and genistein (0.3 mg/kg of body weight), respectively, for 52 days. The results of this study indicate that the effect of methanol extract from soybean caused weight gain, and the weight of the testis and epididymis decreased. In addition, the histological results showed that seminiferous tubules were reduced in size, became irregular, were separated by a wide interstitium, and spermatogenic cells were decreased. The immunohistochemical results showed that the expression of Cyp19 aromatase in the rats decreased both in spermatocyte cells and Leydig cells. It could be concluded that the methanol extract of soybean induced testicular damage and reduced Cyp19 aromatase expression in rat testis.
Sitotoksisitas Fraksi Piper porphyrophyllum terhadap Sel Kanker T47D Yus Hargono Cahyaning Yudi; Hartanto Nugroho
BIO-SITE |Biologi dan Sains Terapan Vol. 2 No. 2 (2016): Bio-Site
Publisher : Biology Department, Faculty of Science and Technology, Univeristas Jambi, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Genus Piper has been using traditionally as medicines. Piper aborescen, P. crocatum, P. Imperiale, P. longum, and P. methysticum have ability to inhibit breast cancer proliferation. This research goal is to know cytotoxic activity of Piper porphyrophyllum fraction against T47D cancer cell. Extraction it’s leaves use soxhlet with chloroform as solvent then use vacuum liquid chromatography. Cytotoxic activity of Piper porphyrophyllum fraction determined by MTT assay. The result showed that fraction group A has lowest IC50 (36.22 µg/ml).
STRUKTUR ANATOMI DAN AKTIVITAS ANTIOKSIDAN BULBUS BAWANG DAYAK (Eleutherine americana MERR.) DARI DAERAH KALIMANTAN SELATAN Evi Mintowati Kuntorini; Maria Dewi Astuti; L. Hartanto Nugroho
JURNAL PENELITIAN BIOLOGI BERKALA PENELITIAN HAYATI Vol 16 No 1 (2010): December 2010
Publisher : The East Java Biological Society

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.23869/276

Abstract

The aim of this research were to study the characterization of the microscopic anatomy and testing the antioxidant activity of bawang dayak bulb from several regions in South Kalimantan. Bawang dayak plant samples taken from four (4) regency in South Kalimantan. Bulb anatomical structure was observed by the paraffin method and test preparations of antioxidant activity by DPPH method. IC50 values were calculated based on the formula of the regression equation.The bulb anatomical structures has an epidermis tissue of both surfaces, there is parenchymal tissue. Transport tissue were located in rows with collateral type, there are starch grains in parenchyma cells, and the presence of stiloid crystals between cells parenkim. Extract ethanol bawang dayak bulb from the four districts in South Kalimantan has antioxidant activity against DPPH radicals. The highest antioxidant activity showed on the sample from location1 Comets Village Banjarbaru Municipality (IC50 = 25.3339 μg/ml) and the lowest showed on the sample from location 2 Sungai Paring Village Banjar District (IC50 = 86.9039 μg/ml). Antioxidant activity of bawang dayak extract 4.5 to 15 times weaker compared to BHT (BHT IC50 = 5.5707 μg/ml).
CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon) Tri Joko Raharjo; Rosyida Azis Rizki; Stalis Norma Ethica; Elly Rustanti; L. Hartanto Nugroho
Indonesian Journal of Chemistry Vol 11, No 3 (2011)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (338.3 KB) | DOI: 10.22146/ijc.21388

Abstract

Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS) encoding gene from melinjo plant (Gnetum gnemon L.) has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3') and GGR2 (5' CTGGATCGCACATCC TGGTG 3') primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Penetapan Kadar Genistein Dalam Ekstrak Metanol BijiKedelai Glycine Max L. Merr. Varietas Grobogan MenggunakanMetode KLT Dan HPLC Retno Aryani; Pudji Astuti; Soekarti Moeljopawiro; Laurentius Hartanto Nugroho
BIOPROSPEK: Jurnal Ilmiah Biologi Vol 10 No 2 (2015): Bioprospek: Jurnal Ilmiah Biologi: Volume 10 Number 2 2015
Publisher : Jurusan Biologi, Fakultas Matematika dan Ilmu Pengetahuan Alam

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (572.279 KB)

Abstract

Soybean (Glycine max L. Merr.) is one of the foodstuffs that are oftenconsumed most of Indonesian. Soy contains phytoestrogens, whichhave chemical structures resemble the hormone estrogen in the body,namely the isoflavones, especially genistein. Genistein is known notonly have various beneficial physiological effects but also act as anendocrine disruptor is because estrogen can play a role as well asantiestrogen activity that affects the metabolism of sex hormones andrelated activities biologi. The objective of this study was to know thequality of genistein in soy extracts Grobogan varieties that have beenpeeled the husk with Thin Layer Chromatography (TLC) and thequantity of soy extract genistein levels Grobogan varieties that havebeen peeled the husk with a method of High Performance LiquidChromatography (HPLC). The method used for extraction ofisoflavones genistein is maceration. Soybean seed samples which havebeen hulled begins with removal of non polar compounds byextraction using n-hexane solvent extraction followed macerationusing 80% methanol. The methanol extract obtained fractionated witha stationary phase of silica gel GF 254, the mobile phase toluene-ethylacetate-aseton- formic acid 20: 4: 2: 1 (v / v). To determine whether ornot a compound genistein compounds in the extract by using acomparison standard genistein further Rf sample extract comparedwith the price of a standard Rf. While the determination of genisteincompound quantitatively with HPLC method genistein standard wear≥ 98% at a concentration of 2, 4, 6, 8, 10 ppm. The identification ofgenistein using Thin Layer Chromatography (TLC), shows the stainsthat have Rf of about 0.43. Results genistein content by HPLC showedpeaks of the chromatograms that have a retention time of about 2,050minutes. HPLC analysis results in three replication showed levels ofgenistein in soya bean varieties Grobogan was 1 g samples of soyextracts that have been flayed husk there was an average of 0.6356 mggenistein. In the soybean seed Grobogan varieties contains isoflavonesgenistein. Levels of genistein in 1 g of sample soy extracts Groboganvarieties that have been flayed epidermis was an average of 0.6356 mggenistein.
Pengaruh Konsentrasi Sukrosa terhadap Kadar Piperin pada Kalus Cabe Jawa (Piper retrofractum Vahl.) Dewi, Kartika Puspita; Nugroho, Laurentius Hartanto; Sasongko, Aries Bagus; Hidayati, Lisna
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 8, No 2 (2023): June 2023
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v8i2.6347

Abstract

Cabe jawa (Piper retrofractum Vahl.) merupakan tanaman herbal yang mengandung alkaloid utama piperin. Prospek cabe jawa sebagai bahan obat belum didukung oleh ketersediaan bahan baku yang cukup, karena rendahnya produktivitas tanaman. Salah satu alternatif untuk mengatasi permasalahan tersebut adalah dengan menerapkan kultur kalus. Kalus dapat memproduksi metabolit sekunder relatif cepat dan berkelanjutan. Efektivitas produksi metabolit sekunder seperti piperin pada kalus dapat dilakukan dengan meningkatkan konsentrasi sukrosa dalam medium kultur. Penelitian ini dilakukan untuk mengetahui pengaruh konsentrasi sukrosa pada morfologi kalus, pertumbuhan kalus, dan produksi piperin pada kalus cabe jawa. Medium Murashige and Skoog (MS), dan zat pengatur tumbuh naphtalene asetic acid (NAA) dan benzyl aminopurin (BAP) 1:2 digunakan untuk menginduksi kalus dari daun cabe jawa. Kalus yang terbentuk berwarna hijau muda dan kompak. Kalus disubkultur selama 35 hari pada medium MS dengan konsentrasi sukrosa 30 g/L, 40 g/L, 50 g/L, dan 60 g/L. Setelah inkubasi warna kalus berubah dengan tekstur tetap kompak. Berat segar dan berat kering dari kalus menurun dengan bertambahnya konsentrasi sukrosa. Piperin pada kalus diekstraksi dengan etanol 96% dan diukur kadarnya dengan Kromatografi Lapis Tipis (KLT)-Densitometri. Peningkatan konsentrasi sukrosa pada medium kulur tidak berpengaruh pada kadar piperin dari kalus cabe jawa. 
Effectiveness extract of Crataeva nurvala leaves as insecticide against Spodoptera litura Ma'rufah, Hastini; Nugroho, L. Hartanto; Sukirno, Sukirno
Communications in Science and Technology Vol 9 No 2 (2024)
Publisher : Komunitas Ilmuwan dan Profesional Muslim Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21924/cst.9.2.2024.1536

Abstract

Spodoptera litura Fabricius, an insect pest, is known to be highly detrimental to farmers for having a variety of host plants. The application of synthetic insecticides to eradicate pests has been proven to bring many negative impacts, especially regarding the cases of resistance and the presence of residues that are harmful to the environment. This study aims to study the effectiveness of potential bioactive compounds of Tigarun leaves (Crataeva nurvala Buch. Ham) as the biochemical insecticides of S. litura. Tigarun plant, widely used as traditional medicine, contains the potential bioactive compounds for bioinsecticides. The extraction process was carried out by maceration using methanol and ethyl acetate solvents, which were then identified for compound content through GCMS analysis. The bioassay method was performed using the test parameters of mortality and eating power of S. litura instar II larvae. The crude extracts from the two solvents obtained showed their effectiveness as bioinsecticides against S. litura instar II larvae. The highest efficacy occurred in the ethyl acetate extract using the contact poison method with the lowest LC50 value of 0.11. Both extracts were also able to reduce the appetite and provide sublethal effects on S. litura larvae. GCMS analysis indicated the presence of several compounds as insecticides in both Tigarun leaf extracts such as 1,2,3-Propanetriol (CAS) Glycerol; Tetradecanoic acid (CAS) Myristic acid; 9-Hexadecenoic acid; n-Hexadecanoic acid; oleic acid; Heneicosane; and Neophytadiene and several other compounds. This study recommends Tigarun leaf extract (C. nurvala) ethyl acetate with the contact method as a natural insecticide against S. litura.
Co-Authors Aditya Krishar Karim Araujo, Otilda Fatima Ari Indrianto Aries Bagus Sasongko, Aries Bagus Dewi, Kartika Puspita Elizabeth Betty Elok Kristiani Elly Rustanti Evi Mintowati Kuntorini Kumiko Terada Linus Yhani Chrystomo Lisna Hidayati, Lisna Ma'rufah, Hastini Maria Dewi Astuti Maturbongs, Agatha Maturbongs, Rudi A. Pudji Astuti Rahmawati, Rahmawati Rarastoeti Pratiwi Retno Aryani Riris Istighfari Jenie Rosyida Azis Rizki Santosa Santosa Soekarti Moeljopawiro Sri Kasmiyati Stalis Norma Ethica Subagus Wahyuono Sukarti Moeljopawiro Sukirno Sukirno Tri Joko Raharjo Tri Rini Nuringtyas Tsutomu Nohno Yulita Nurchayati Yus Hargono Cahyaning Yudi Zulkifli Zulkifli