Article Per Year (5 Year)
p-Index From 2021 - 2026
0.23
P-Index
This Author published in this journals
All Journal Jurnal Biosense
Yasmine Dwinda
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Immunology & microbiology Medicine & Pharmacology Public Health

Published : 1 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 1 Documents
Search

 1 
DESAIN PRIMER MMP-8 dan IL-6 UNTUK ANALISIS EKSPRESI GEN JARINGAN GUSI Rattus norvegicus DENGAN qRT-PCR Yasmine Dwinda; Farikh, Muhammad; Tiranissa, Vraya; Sari, Windi Yunita; Ramadhan, Bintang Fadhil; Farma, Siska Alicia
JURNAL BIOSENSE Vol 9 No 1 (2026): Edisi Januari 2026
Publisher : Program Studi Biologi, Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas PGRI Banyuwangi, Jalan Ikan Tongkol No 01, Telp (0333) 421593, 428592 Banyuwangi 68416

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36526/biosense.v9i1.7222

Abstract

Matrix Metalloproteinase 8 (MMP-8) and Interleukin 6 (IL-6) are two important genes that mediate inflammation and play a role in inflammatory cases. This study aims to design two specific primer candidates for testing gene expression using the qRT-PCR method in Rattus norvegicus experiencing inflammation and gingivitis. Primer design was performed using Geneious Prime software and BLAST primers to determine primer quality through PCR product size, primer length, melting temperature (Tm), and %GC, as well as to ensure that the resulting primers only bind to the Rattus norvegicus genome target. The results showed that the size of the MMP-8 forward product CGGGGTATTGGAGGAGATGC; reverse CAGGGTTGTCTGAAGGTCCATA was 241 bp with a primer length of 20-22 nucleotides, %GC between 50-60%, and Tm not more than 60°C, and the size of the IL-6 product forward AGAGACTTCCAGCCAGTTGC; reverse TGCCATTGCACAACTCTTTTC is 199 bp with a primer length of 20-21 nucleotides, %GC between 42.86-55% and Tm not more than 60°C. BLAST primer results indicate that both primer pairs are specific and suitable as candidate primers for qRT-PCR testing in studies of inflammation-related gene expression and gingival inflammation.
Co-Authors Farikh, Muhammad Ramadhan, Bintang Fadhil Sari, Windi Yunita Tiranissa, Vraya