Article Per Year (5 Year)
p-Index From 2021 - 2026
0.408
P-Index
This Author published in this journals
All Journal Jurnal Biologi Tropis Jurnal Biosense
Sari, Windi Yunita
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Immunology & microbiology Medicine & Pharmacology Public Health

Published : 2 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 2 Documents
Search

 1 
DESAIN PRIMER MMP-8 dan IL-6 UNTUK ANALISIS EKSPRESI GEN JARINGAN GUSI Rattus norvegicus DENGAN qRT-PCR Yasmine Dwinda; Farikh, Muhammad; Tiranissa, Vraya; Sari, Windi Yunita; Ramadhan, Bintang Fadhil; Farma, Siska Alicia
JURNAL BIOSENSE Vol 9 No 1 (2026): Edisi Januari 2026
Publisher : Program Studi Biologi, Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas PGRI Banyuwangi, Jalan Ikan Tongkol No 01, Telp (0333) 421593, 428592 Banyuwangi 68416

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36526/biosense.v9i1.7222

Abstract

Matrix Metalloproteinase 8 (MMP-8) and Interleukin 6 (IL-6) are two important genes that mediate inflammation and play a role in inflammatory cases. This study aims to design two specific primer candidates for testing gene expression using the qRT-PCR method in Rattus norvegicus experiencing inflammation and gingivitis. Primer design was performed using Geneious Prime software and BLAST primers to determine primer quality through PCR product size, primer length, melting temperature (Tm), and %GC, as well as to ensure that the resulting primers only bind to the Rattus norvegicus genome target. The results showed that the size of the MMP-8 forward product CGGGGTATTGGAGGAGATGC; reverse CAGGGTTGTCTGAAGGTCCATA was 241 bp with a primer length of 20-22 nucleotides, %GC between 50-60%, and Tm not more than 60°C, and the size of the IL-6 product forward AGAGACTTCCAGCCAGTTGC; reverse TGCCATTGCACAACTCTTTTC is 199 bp with a primer length of 20-21 nucleotides, %GC between 42.86-55% and Tm not more than 60°C. BLAST primer results indicate that both primer pairs are specific and suitable as candidate primers for qRT-PCR testing in studies of inflammation-related gene expression and gingival inflammation.
Effects of Young Coconut Water and Honey as Solvents on Clarias gariepinus Catfish Sperm Viability Sari, Windi Yunita; Atifah, Yusni
Jurnal Biologi Tropis Vol. 26 No. 1 (2026): Januari-Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v26i1.11277

Abstract

African catfish (Clarias garieipinuis) is an important aquiacuiltuirei speicieis, and thei suicceiss of its hatcheiry strongly deipeinds on speirm quiality. Syntheitic eixteindeirs arei commonly uiseid for speirm preiseirvation, buit theiir high cost and poteintial biological risks highlight thei neieid for natuiral, safei, and affordablei alteirnativeis. This stuidy eivaluiateid thei eiffeict of honeiy conceintrations in youing coconuit wateir on speirm viability. Speirm sampleis weirei colleicteid from matuirei maleis uising thei stripping meithod and diluiteid with eixteindeirs containing 0%, 3%, 6%, and 9% honeiy, thein storeid at 5 °C for fouir days in a compleiteily randomizeid deisign with threiei reiplicateis peir treiatmeint. Speirm viability was asseisseid daily and analyzeid uising onei-way ANOVA. Thei higheist viability was obseirveid in thei 3% honeiy treiatmeint (77.47%), whilei thei loweist was in thei 9% treiatmeint (52.71%). Modeiratei honeiy conceintrations teindeid to beitteir maintain speirm viability, likeily duiei to osmotic and proteictivei eiffeicts of honeiy bioactivei compouinds. Theisei findings suiggeist that youing coconuit wateir suippleimeinteid with honeiy can seirvei as a natuiral, cost-eiffeictivei, and einvironmeintally frieindly eixteindeir, providing a practical option for hatcheiry opeirations and contribuiting to thei deiveilopmeint of suistainablei reiproduictivei teichnologieis for African catfish.
Co-Authors Atifah, Yusni Farikh, Muhammad Ramadhan, Bintang Fadhil Tiranissa, Vraya Yasmine Dwinda