cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
Brigitta Laksmi Paramita
Contact Email
brigitta.laksmi@uajy.ac.id
Phone
+6282329549978
Journal Mail Official
journal.biota@gmail.com
Editorial Address
Fakultas Teknobiologi, Universitas Atma Jaya Yogyakarta, Jalan Babarsari No. 44, Sleman, Yogyakarta 55281, Indonesia
Location
Kota yogyakarta,
Daerah istimewa yogyakarta
INDONESIA
Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati
Published by Universitas Atma Jaya Yogyakarta
ISSN : 25273221     EISSN : 2527323X     DOI : doi.org/10.24002/biota
Core Subject : Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology
Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati merupakan jurnal ilmiah yang memuat hasil-hasil penelitian, kajian-kajian pustaka dan berita-berita terbaru tentang ilmu dan teknologi kehayatian (biologi, bioteknologi dan bidang ilmu yang terkait). Biota terbit pertama kali bulan Juli 1995 dengan ISSN 0853-8670. Biota terbit tiga nomor dalam satu tahun (Februari, Juni, dan Oktober).
Arjuna Subject : Ilmu Pertanian dan Biologi (Semua) - Ilmu Pertanian dan Biologi (Lain-Lain)
Articles 18 Documents
 1   2 
Search results for , issue "Vol 12, No 3 (2007): October 2007" : 18 Documents clear
Pengaruh Jenis Prebiotik terhadap Kualitas Yogurt Probiotik Purwijantiningsih, Ekawati
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 3 (2007): October 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (196.594 KB) | DOI: 10.24002/biota.v12i3.652

Abstract

Prebiotics are variety of nondigestible carbohydrates that help promote the growth of good bacteria in the intestines. Prebiotics are found naturally in legumes, vegetables, fruits and tubers. Soybean, banana and tapioca are supposed to have potential as prebiotics, promote a healthy digestive system and reduce the growth of harmful bacteria. Soybean, banana and tapioca were investigatedon their abilities to promote the quality of probiotic yogurt. Soybean flour addition to probiotic yogurt most potential to promote nutrition value and lactic acid bacteria viability. The most preference of probiotic yogurt by panelists is probiotic yogurt added tapioca.
Model Pertumbuhan Populasi untuk Pengendalian Populasi Akasia Berduri (Acacia nilotica (L.) Willd. Ex Del.) di Taman Nasional Baluran Supriyadi, Supriyadi
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 3 (2007): October 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (225.805 KB) | DOI: 10.24002/biota.v12i3.2803

Abstract

The savannas in Baluran National Park have been severely invaded by Acacia nilotica. The invasion reduced grazing areas and created wildlife watching problems for tourists. Therefore, population control management should be developed. The aim of the study was to construct a population growth model in relation to the control of the population in the park. The model was an age structured one which consisted of seed class, age class <1 year, age class 1-<2 years, age class 2-<3 years, age class 3-<4 years, and age class 4 years. It was assumed that a temporary seed bank exists; there is no seed dormancy; seeds are produced by age class 4 years; and the number of seedlings is determined by available space. The population size was expressed as the number of individuals per hectare. The population control scenario included effects of complete elimination and partial elimination in the first year. Each of those was combined with seed harvesting. The total population growth pattern generated by the model was similar to the logistic one but with a bit oscillation before a stable population size was reached. More important parameters in the model were germination rate, seedling survival rate, number of seeds per individuals, maximum population size, and survival rate of age class 4. The simulation results showed that control measures of the population were effective when seed harvesting was carried out. A periodic partial elimination combined with seed harvesting might be useful. Seed harvesting should be applied every year to retard the growth and to prevent the spread of A. nilotica populations in the savannas.
Kajian Penanda Genetik Tarsius bancanus dan Tarsius spectrum dengan Sekuen D-Loop Parsial DNA Mitokondria Widayanti, Rini; Solihin, Dedi Duryadi
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 3 (2007): October 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (307.5 KB) | DOI: 10.24002/biota.v12i3.2804

Abstract

The objective of this research was to study the specific genetic marker on D-loop region of Tarsius bancanus and Tarsius spectrum. The sequencing of PCR product using primer DLTARPROF on D-loop resulted in base sequence of 270 nts. Result of D-loop fragments sequencing was put on multiple alignment with other primates from Genbank with the aid of software Genetyc-Win Version 3.0 and Clustal W, and was analyzed using MEGA program version 3.1. The genetic distance was based on nucleotide D-loop, the smallest genetic distance was 0% and the biggest was 11.8% and the average was 2.3%. The phylogenetic tree using neighbor Joining Method based on some nucleotide sequence on D-loop region could not be used to differentiate between Tarsius bancanus and Tarsius spectrum.
Jenis Tanaman Berguna Bagi Suku Dani di Lembah Baliem, Papua (Short Communication) Arobaya, Agustina; Pattiselanno, Freddy
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 3 (2007): October 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (155.11 KB) | DOI: 10.24002/biota.v12i3.2806

Abstract

Dua studi lapangan yang terpisah telah dilakukan di Lembah Baliem (138030’– 139030’ BT dan 3400’ – 4200’LS) Papua untuk mengidentifikasi jenis-jenis tanaman berguna bagi suku Dani yang hidup di lembah tersebut. Studi lapangan pertama dilakukan selama lima bulan (Maret – Juli 1994) di Mume-Kuyawage dan Mapnduma. Studi ini merupakan bagian dari program kajian ekologi Taman Nasional Lorentz dari WWF. Studi kedua merupakan observasi singkat (21 - 26 Mei 2005) di sekitar kota Wamena yakni Kumima, Siapkosi, Napua, Sinakma, Pisugi, Wanima, Sunili, Tulem dan Woma. Studi ini bagian dari penelitian usaha peternakan tradisional kerjasama Dinas Peternakan Kabupaten Jayawijaya, International Potato Centre (CIP) Bogor and South Australian Research and Development Institute (SARDI). Investigasi langsung dilakukan diikuti dengan wawancara semi-struktural untuk menghimpun informasi tentang jenis tanaman berguna yang biasanya dimanfaatkan oleh suku Dani.
Studi Pakan Burung Perkici Pelangi (Trichoglossus haematodus Linnaeus, 1771) dalam Laboratorium Penangkaran Widodo, W.
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 3 (2007): October 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (343.243 KB) | DOI: 10.24002/biota.v12i3.2801

Abstract

During the 2002-2003 period, the research was done to study 11 Rainbow Lorikeets reared in an animal house laboratory. The aim of this research was to find the food rations formule of the Rainbow Lorikeets so that those birds can be able to grow and breed well. The food rations were composed of 26.3% local bird foods (521), 35.09% lampung bananas, 8.77% slice corns, 10.5% boiled quails eggs, 1.75% white bread, bean sprouts and red sugar are 8.77%, respectively. All of food materials were mixed on the plastic cup and mixed with 450 ml of water, then pulverized like sweet porridge. That porridge was given to birds in cafeteria and the water was made ready “ad libitum” everyday. The results have shown that giving food rations formula can stimulate two pairs of the Rainbow Lorikeets breeding and during the 2002-2003 period they produced three young birds.
Penapisan Aktivitas Selulase Isolat-isolat Khamir dari Moluska, Serasah, dan Tumbuhan di Taman Nasional Gunung Halimun, Jawa Barat Mangunwardoyo, Wibowo; Fitri, Reno; Oetari, Ariyanti
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 3 (2007): October 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (297.223 KB) | DOI: 10.24002/biota.v12i3.2805

Abstract

A total of 236 yeast isolates from mollusc, litter, and plant samples from Gunung Halimun National Park were screened for cellulolytic activity based on Smith method by using 0,2% (w/v) cellulose-azure for 30 days. The results showed that 12 isolates (9 isolates from plants, 2 isolates from molluscs, dan 1 isolate from litter) have cellulolytic activity. These isolates were further screened based on Teather and Wood method for six days to determine their cellulases components by using specific substrates. Carboxymethyl cellulose (CMC) 0,1% (w/v) was used as a specific substrate to determine endoglucanase activity. Avicel 0,1% (w/v) was used as a specific substrate to determine exoglucanase activity. Cellobiose 0,1% (w/v) was used as a specific substrate to determine β-glucosidase activity. The results showed that 6 isolates from plant have β-glucosidase activity, and 1 isolate from plant have β-glucosidase and endoglucanase activities. Five isolates (2 isolates from plants, 2 isolates from molluscs, and 1 isolate from litter) showed no cellulase activity on specific substrates after six days incubation.
Identifikasi Awal Bakteri pada Juwana Trochus niloticus Linn. dan Tridacna squamosa Linn. Asal Hatchery Pulau Barrang Lompo Makassar Litaay, Magdalena; Gobel, Risco B.; Abdullah, As’adi; Subair, Subair
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 3 (2007): October 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (458.708 KB) | DOI: 10.24002/biota.v12i3.2800

Abstract

The research on early identification of bacterial from juveniles top shell (Trochus niloticus L.) and giant clam (Tridacna squamosa Linn.) was conducted at Unhas’s hatchery at Barrang Lompo island during August-October 2006. Bacteriology test was done at Microbiology Laboratory of Biology Department, Math and Science Faculty, Hasanuddin University, Makassar. The quantitative test was done using Most Probable Number (MPN) and Standard Plate Count (SPC) methods. While the qualitative test included bacteria colony observation, macroscopic, microscopic, and biochemical test. Macroscopic observation was done by assessing the form, elevation, color, ridge, and inner structure of bacterial colony. Microscopic observation was conducted by using Gram and spora stain. The result of MPN method shows the average total bacteria for juveniles top shell is 17.5 x 102 cell/ml and for giant clam is 6.65 x 102 cell/ml, while SPC results indicate the average total bacteria for juveniles top shell is 4.8 x 105 cell/ml and for giant clam is 3.0 x 105 cell/ml, respectively. The result of biochemical test identifies 5 genera of bacteria such as Micrococcus, Bacillus, Streptomyces, Escherichia and Enterobacter.
Menggugat Bias Temperate dalam Ekologi Perilaku Burung (Kajian Buku) Yuda, Ign. Pramana
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 3 (2007): October 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (125.764 KB) | DOI: 10.24002/biota.v12i3.2808

Abstract

Daerah tropis memiliki keanekaragaman jenis yang tinggi, misalnya saja lebih kurang 80% jenis burung petengger (passerine bird) hidup dan berbiak di daerah tropis. Namun barangkali belum banyak yang mengetahui bahwa beberapa teori dalam biologi dan ekologi burung lebih banyak didasarkan pada pengamatan empirik dan pemodelan yang menggunakan jenis burung dari daerah beriklim sedang (temperate). Hal ini tidak terlepas dari persebaran ahli yang sebagian besar terkonsentrasi dan melakukan penelitian di daerah tersebut baik Eropa maupun Amerika Utara. Celakanya, pola perilaku burung, misalnya, yang ditemukan di daerah tersebut selama ini telah dianggap sebagai norma perilaku umum untuk semua jenis burung. Apakah jenis-jenis burung di daerah tropis mengikuti norma perilaku umum tersebut?
Keragaman Daerah Kontrol DNA Mitokondria Rusa Timor (Cervus timorensis timorensis) di Pulau Timor, Alor, dan Pantar Zein, M. Syamsul
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 3 (2007): October 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v12i3.2799

Abstract

A study on mtDNA control region diversity of the timor deer was conducted in EastNusa Tenggara Province. Sample consisted of 20 individuals from 3 islands (Timor,Pantar, and Alor). Total DNA were extracted from leucocyte (buffy coat). Fragmentcontrol region of the mitochondrial DNA were amplified by Polymerase ChainReaction (PCR) using primers of forward primer5”AAACCAGAAAAGGAGAGCAAC3” and reverse primer5”TCATCTAGGCATTTTCAGTGCC3”. Nucleotide sequence of the mitochondrialcontrol region were aligned by using ClastalX and phylogenetic analyses by Neighbor-Joining methode. Kimura two-parameter model of nucleotide substitution usingpairwise distance calculation program was implemented with the Mega softwareversion 3. The purposes of this study, were to examine the control region (D-Loop) ofthe mitochondrial DNA and to discuss the phylogeography of the Cervus timorensistimorensis in East Nusa Tenggara Province. Results indicated that from 435 basenucleotide sequences, 16 polymorphic sites with 8 haplotypes were found among 3islands. Haplotype diversity and nucleotide diversity were 0.056 and 0.039. DNAdistances values ranged from 0.014 to 0.021.
Pengaruh Jenis Prebiotik terhadap Kualitas Yogurt Probiotik Ekawati Purwijantiningsih
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 3 (2007): October 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v12i3.652

Abstract

Prebiotics are variety of nondigestible carbohydrates that help promote the growth of good bacteria in the intestines. Prebiotics are found naturally in legumes, vegetables, fruits and tubers. Soybean, banana and tapioca are supposed to have potential as prebiotics, promote a healthy digestive system and reduce the growth of harmful bacteria. Soybean, banana and tapioca were investigatedon their abilities to promote the quality of probiotic yogurt. Soybean flour addition to probiotic yogurt most potential to promote nutrition value and lactic acid bacteria viability. The most preference of probiotic yogurt by panelists is probiotic yogurt added tapioca.

Page 1 of 2 | Total Record : 18

 1   2 

Filter by Year

2007 2007


Reset
Filter By Issues
All Issue Vol 10, No 3 (2025): October 2025 Vol 10, No 2 (2025): June 2025 Vol 10, No 1 (2025): February 2025 Vol 9, No 3 (2024): October 2024 Vol 9, No 2 (2024): June 2024 Vol 9, No 1 (2024): February 2024 Vol 8, No 3 (2023): October 2023 Vol 8, No 2 (2023): June 2023 Vol 8, No 1 (2023): February 2023 Vol 7, No 3 (2022): October 2022 Vol 7, No 2 (2022): June 2022 Vol 7, No 1 (2022): February 2022 Vol 6, No 3 (2021): October 2021 Vol 6, No 2 (2021): June 2021 Vol 6, No 1 (2021): February 2021 Vol 5, No 3 (2020): October 2020 Vol 5, No 2 (2020): June 2020 Vol 5, No 1 (2020): February 2020 Vol 4, No 3 (2019): October 2019 Vol 4, No 2 (2019): June 2019 Vol 4, No 1 (2019): February 2019 Vol 4, No 1 (2019): February 2019 Vol 3, No 3 (2018): October 2018 Vol 3, No 2 (2018): June 2018 Vol 3, No 1 (2018): February 2018 Vol 3, No 1 (2018): February 2018 Vol 2, No 3 (2017): October 2017 Vol 2, No 2 (2017): June 2017 Vol 2, No 1 (2017): February 2017 Vol 2, No 1 (2017): February 2017 Vol 1, No 3 (2016): October 2016 Vol 1, No 2 (2016): June 2016 Vol 1, No 1 (2016): February 2016 Vol 1, No 1 (2016): February 2016 Vol 19, No 1 (2014): February 2014 Biota Volume 19 Nomor 1 Tahun 2014 Biota Volume 13 Nomor 2 Tahun 2014 Vol 18, No 2 (2013): June 2013 Vol 18, No 1 (2013): February 2013 Biota Volume 18 Nomor 1 Tahun 2013 Vol 17, No 3 (2012): October 2012 Vol 17, No 2 (2012): June 2012 Vol 17, No 1 (2012): February 2012 BIOTA Volume 17 Nomor 3 Tahun 2012 Vol 16, No 2 (2011): June 2011 Vol 16, No 2 (2011): June 2011 Vol 16, No 1 (2011): February 2011 Vol 16, No 1 (2011): February 2011 Vol 15, No 3 (2010): October 2010 Vol 15, No 2 (2010): June 2010 Vol 15, No 1 (2010): February 2010 Vol 14, No 3 (2009): October 2009 Vol 14, No 2 (2009): June 2009 Vol 14, No 1 (2009): February 2009 Vol 13, No 3 (2008): October 2008 Vol 13, No 2 (2008): June 2008 Vol 13, No 1 (2008): February 2008 Vol 12, No 3 (2007): October 2007 Vol 12, No 2 (2007): June 2007 Vol 12, No 1 (2007): February 2007 Vol 11, No 3 (2006): October 2006 Vol 11, No 2 (2006): June 2006 Vol 11, No 1 (2006): February 2006 Vol 10, No 3 (2005): October 2005 Vol 10, No 2 (2005): June 2005 Vol 10, No 1 (2005): February 2005 Vol 9, No 3 (2004): October 2004 Vol 9, No 2 (2004): June 2004 Vol 9, No 1 (2004): February 2004 Vol 8, No 3 (2003): October 2003 Vol 8, No 2 (2003): June 2003 Vol 8, No 1 (2003): February 2003 More Issue