Garuda - Garba Rujukan Digital

Article Per Year (5 Year)

All

Journal of Biomedicine and Translational Research

jbtr
Website

Published by Universitas Diponegoro

ISSN : - EISSN : 25032178 DOI : -

Core Subject : Health, Science,

Biochemistry, Genetics & Molecular Biology Medicine & Pharmacology

Journal of Biomedicine and Translational Research (JBTR) is an open access, international peer-reviewed journal that considers articles on: clinical medicine, molecular medicine, tropical medicine, infectious diseases, cardiovascular medicine, molecular biology, genetics, immunology, microbiology, biochemistry, and pharmacotherapy with particular interest on the link between clinical and basic research called translational research.

Arjuna Subject : -

Articles 5 Documents

Search results for , issue "Vol 3, No 1 (2017): July 2017" : 5 Documents clear

Active Cytomegalovirus Infection in Critically Ill Immunocompeten Patients Admitted in the ICU. A Molecular Diagnosis Approach Minuljo, Tania Tedjo; Gasem, Muhammad Hussein; Hadi, Purnomo
Journal of Biomedicine and Translational Research Vol 3, No 1 (2017): July 2017
Publisher : Faculty of Medicine, Universitas Diponegoro

Background: Active Cytomegalovirus (CMV) infection has long been related to immunocompromised conditions such as malignancy, HIV-AIDS, longterm use of corticosteroids and organ transplantation. Nowadays, several studies showed that active CMV infection also frequently found in formerly immunocompetent patients during critically ill condition. Alteration of immune system in critically ill condition might become the most possible reason enderlying this adverse event.Aim: To document the prevalence of active CMV infection in critically ill immunocompetent patient admitted to ICU and to find out the difference of the disease severity between group of patients with and without active CMV infection.Method: This was a cross sectional study. Study conducted from April 1st - June 30th 2013. Subjects were patient aged ≥14 years, hospitalized in the ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Patients who had history of malignancy, HIV-AIDS, use of corticosteroids and organ transplatation were excluded from the study. Disease severity was calculated using APACHE II score in the first 24 hours of ICU admission. EDTA sample for qualitative PCR examination (procedure as described elsewhere) collected after 4 days of ICU admission. Primer for CMV were as follow CMV-F: CATGAAGGTCTTTGCCCAGTAC, CMV-R: GGCCAAAGTGTAGGCTACAATAG. Datas were analyzed using bivariate analysis.Result: Active CMV infection was detected in 16 out of 50 subjects. Mean score of disease severity in all subjects (based on APACHE II scoring system) was 11.8±6.43. Mean score of disease severity in group with active CMV infection was higher than group without active CMV infection, but not differ significantly (12.75 vs. 11.47; p=0,510).Conclusion: The prevalence of active CMV infection in critically ill immunocompetent patient is relatively high (16/50; 32%) in the ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Degree of disease severity might influence the occurance of CMV infection. Qualitative PCR testing was an aqurate tool for diagnosing active CMV infection.

Comparison of Effects on Gene Expression Activity of Low-Molecular-Weight Lychee Fruit Polyphenol (Oligonol®), Adenosine, and Minoxidil in Human Dermal Papilla Cells Koji Wakame; Akifumi Nakata; Keisuke Sato; Yoshihiro Mihara; Jun Takanari; Atuya Sato; Ken-ichi Komatsu
Journal of Biomedicine and Translational Research Vol 3, No 1 (2017): July 2017
Publisher : Faculty of Medicine, Diponegoro University

Background: Oligonol® (OLG) is a functional food product and ingredient for cosmetics derived from a lychee fruit polyphenol. It has been reported to act on the skin as an anti-inflammatory and prevent UVB-induced skin damage.Aim: In this study, with the aim of exploring new functionalities of OLG on the scalp, we investigated the effect of OLG on human dermal papilla cells by comparing with adenosine and minoxidil at the genetic level.Method: OLG, adenosine, and minoxidil were applied to human dermal papilla cell lines for 24 h, after which VEGF, FGF-7, WNT5a, and WNT10a mRNA expressions were measured by real-time PCR analysis. Additionally, using DNA microarrays, we investigated the effect on 205 inflammation-related genes.Result: Consequently, in human dermal papilla cell lines, FGF-7 and WNT10a mRNA expression were observed in 100 µg/mL OLG-supplemented cells. The results of the DNA microarray analysis showed that 10 genes were suppressed by OLG.Conclusions: OLG may be expected to affect function of human dermal papilla cell by regulating the expression of genes related to cell proliferation and inflammation.

Comparison of Prostaglandin Analogue and Selective Laser Trabeculoplasty Capability to Maintain Intraocular Pressure Fluctuation on Primary Open Angle Glaucoma Sara Listyani Koentjoro; Maharani Cahyono; Fifin Luthfia Rahmi
Journal of Biomedicine and Translational Research Vol 3, No 1 (2017): July 2017
Publisher : Faculty of Medicine, Diponegoro University

Background: Glaucoma patients often come with intraocular pressure (IOP) that reach target pressure, but still have glaucoma progression due to IOP fluctuation. Water drinking test (WDT) can be used as a method to predict IOP fluctuation.Purpose: To compare prostaglandin analogue (PGA) and selective laser trabeculoplasty (SLT) capability to maintain IOP fluctuation on primary open angle glaucoma (POAG).Method: This clinical experimental research was conducted at Dr. Kariadi Hospital. Subjects were POAG patients selected with consecutive sampling. Intraocular pressure was measured before and after WDT. After WDT, IOP was measured every 15 minutes until 1 hour. Peak IOP and IOP fluctuation data were collected then analyzed with t-test.Results: Forty two eyes from 30 POAG patients were analyzed. Twenty six eyes in PGA group and 16 eyes in SLT group. Most of the subjects were male with mild glaucoma degree. WDT increased IOP significantly on both groups. Mean IOP pre WDT was 14.58 ± 2.580 mmHg and 16.94 ± 2.645 mmHg in PGA and SLT groups. Mean peak IOP post WDT was 22.73 ± 4.114 mmHg and 25.75 ± 5.859 mmHg in PGA and SLT groups. Mean IOP fluctuation was 8.15 ± 4.202 mmHg and 8.81 ± 5.344 mmHg in PGA and SLT groups. Peak IOP and IOP fluctuation result analysis on both groups were not significantly different.Conclusion: Prostaglandin analogue and SLT had equal capability to maintain IOP fluctuation but still higher than normal fluctuation (>6 mmHg) that affects glaucoma progression.

Multidisciplinary Management of Disorders of Sex Development in Indonesia, A Prototype in Developing Country Nurin Aisyiyah Listyasari; Ardy Santosa; Achmad Zulfa Juniarto; Sultana MH Faradz
Journal of Biomedicine and Translational Research Vol 3, No 1 (2017): July 2017
Publisher : Faculty of Medicine, Diponegoro University

Background : Disorder of sex development (DSD) patients require comprehensive management to improve quality of life. A standardized management protocol for patients in Indonesia is not yet available resulting in patients infrequently received a proper diagnosis. This study reported a multidisciplinary management DSD in Indonesia based on minimal diagnostic facilities and expertise in developing country.Objectives : The purpose of the study is to review the management of DSD patients in Indonesia relates to providing appropriate gender assignment and to improving patients quality of life.Methodology : We analyzed the records of DSD patient admitted to the division of Human Genetics Center for Biomedical Research (CEBIOR) Faculty of Medicine Diponegoro University, Semarang, Indonesia from May 2004 - December 2015. Data were collected and analyzed for physical examination, family pedigree karyotyping, hormonal assays and psychosocial. Other examination such as ultrasonography, Xray and Cytoscopy were also recorded for selected cases. Bimonthly, Sexual Adjustment Team (SAT) meeting was recorded.Results : From the total 617 DSD cases we found 426 cases (69,04 %) with 46, XY DSD, 117 cases (18,96%) with 46,XX DSD and 74 cases (12%) with sex chromosome DSD. Most of the patients in the group of 46, XY DSD are Unknown Male Undervirilization (UMU) with 256 cases (60.09%). As the majority cases of 46, XX DSD was Congenital Adrenal Hyperplasia with 81 cases (69.23%). The remaining cases were Androgen Action Disorder (AAD) with 140 cases (32.86%), 46, XY DSD Gonadal Dysgenesis with 30 cases (7.04%), Androgen Excess Disorders with 3 cases (2.56%), Defect of Mullerian Development with 19 cases (16,24%), 3 cases (2.56%) of Androgen Excess and 3 cases (2.56%) of 46, XX Gonadal Dysgenesis.Conclusion : Comprehensive management for DSD Patients help patient in diagnosis, gender assignment and support patient to improve quality of life. This multidisciplinary of DSD team is the only team in Indonesia that can be used as a model for other center in Indonesia as well as other developing countries with minimal diagnostic facilities.

CHARGE Syndrome: An Indonesian Case Report Jessica Juan Pramudita; Agustini Utari; Tri Indah Winarni; Sultana MH Faradz
Journal of Biomedicine and Translational Research Vol 3, No 1 (2017): July 2017
Publisher : Faculty of Medicine, Diponegoro University

Background: CHARGE syndrome is an autosomal dominant congenital and rare genetic disease.The prevalence of CHARGE syndrome approximately 1:12,000 births.In the previous study, the CHD7 gene mutation is responsible in about 2/3 cases of CHARGE syndrome. The syndrome associations consist of C-coloboma of the eyes, H-heart disease, A-atresia of the choanae, R-retarded growth and development, G-genital hypoplasia/genitourinary anomalies and E-ear anomalies and/or hearing loss. All defects are not seen in every case and a different spectrum of associations is seen in most of the cases.Method: Case was undergone physical examination by experience pediatricians, pedigree construction, and other diagnostic procedure (X-ray, echocardiography, and multi slice computer tomography (MSCT) scan).Results: A boy aged 2 years 9 months with clinical features with match major and minor criterias of CHARGE syndrome.

Page 1 of 1 | Total Record : 5

Filter by Year

2017 2017

Filter By Issues

All Issue Vol 11, No 3 (2025): December 2025 Vol 11, No 2 (2025): August 2025 Vol 11, No 1 (2025): April 2025 Vol 10, No 3 (2024): December 2024 Vol 10, No 2 (2024): August 2024 Vol 10, No 1 (2024): April 2024 Vol 9, No 3 (2023): December 2023 Vol 9, No 2 (2023): August 2023 Vol 9, No 1 (2023): April 2023 Vol 8, No 3 (2022): December 2022 Vol 8, No 2 (2022): August 2022 Vol 8, No 1 (2022): April 2022 Vol 7, No 3 (2021): December 2021 Vol 7, No 2 (2021): August 2021 Vol 7, No 1 (2021): April 2021 Vol 6, No 3 (2020): December2020 Vol 6, No 2 (2020): Augusts 2020 Vol 6, No 1 (2020): April 2020 Vol 5, No 2 (2019): December 2019 Vol 5, No 1 (2019): July 2019 Vol 4, No 2 (2018): December 2018 Vol 4, No 1 (2018): July 2018 Vol 3, No 2 (2017): December 2017 Vol 3, No 1 (2017): July 2017 Vol 2, No 2 (2016): December 2016 Vol 2, No 1 (2016): July 2016 Vol 1, No 2 (2015): December 2015 Vol 1, No 1 (2015): April 2015 More Issue

Home Page

OAI Link

Editorial Team

Contact

Reviewer

Google Scholar

Contact Name
-

Contact Email
-

Phone
-

Journal Mail Official
-

Editorial Address
-

Location
Kota semarang,

Jawa tengah

INDONESIA

Abstract

Abstract

Abstract

Abstract

Abstract

Home Page

OAI Link

Editorial Team

Contact

Reviewer

Google Scholar

Contact Name -

Contact Email -

Phone -

Journal Mail Official -

Editorial Address -

Location Kota semarang, Jawa tengah INDONESIA

Abstract

Abstract

Abstract

Abstract

Abstract

Contact Name
-

Contact Email
-

Phone
-

Journal Mail Official
-

Editorial Address
-

Location
Kota semarang,

Jawa tengah

INDONESIA