Claim Missing Document
Check
Articles

Found 4 Documents
Search

Assessing the Inter-observer Agreement of Electrocardiography Interpretation in the Elderly Surgical Patients: A Cross-Sectional Study Mupangati, Yudo Murti; Setyawan, Henry; Soejono, Czeresna Heriawan; Gasem, Muhammad Hussein; Riwanto, Ignatius
Medica Hospitalia : Journal of Clinical Medicine Vol. 10 No. 3 (2023): Med Hosp
Publisher : RSUP Dr. Kariadi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36408/mhjcm.v10i3.969

Abstract

Background: Electrocardiography (ECG) is an essential objective diagnosis tool, specifically for the elderly who are about to undergo surgery. From the examination results, it is possible to determine the presence of a heart condition that could impair the surgical outcome. Furthermore, the examination is slightly influenced by the subjectivity of observers. Purpose: To evaluate the inter-observer agreement on the reader of a 12-lead ECG on elderly patients subjected to elective surgery. Method: A consequential ECG examination was conducted on elderly patients who underwent elective surgery at Dr. Kariadi Hospital  Semarang between July and November 2021. Two junior internist observers were independently involved in reading the ECG results in different places. The inter-observer reliability analysis used kappa statistics to determine consistency between observers. Result: Analysis was carried out on 193 patients aged  60-87 years old, with a prevalence of abnormal ECG was 33.7%. Kappa Conformity Value was 0.864 (95 % CI: 0.790-0.938,  p<0.001). Conclusion: The value of agreement between junior internists in ECG interpretation among elderly surgical patients is good (kappa value  >0.8). Even though the observers are junior internist, the result of the interpretation with a high kappa is considered to have reliable validity.
Detection of Pathogenic Leptospira in Sputum of Leptospirosis Patient with Pulmonary Hemorrhage. Handayani, Farida Dwi; Novipuspitasari, Lisa; Ahmed, Ahmed; Safari, Dodi; Hidajat, Muhammad Choirul; Soebandrio, Amin; Gasem, Muhammad Hussein
Journal of Biomedicine and Translational Research Vol 11, No 2 (2025): August 2025
Publisher : Faculty of Medicine, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14710/jbtr.v11i2.28259

Abstract

Background: The pathogenic Leptospira species is the causative agent of leptospirosis, an endemic zoonotic disease in Indonesia. Misdiagnosis of the disease frequently occurs, as confirmatory diagnosis confined to highly specialized laboratories. As well, the pulmonary involvement of leptospirosis with hemoptysis is scarcely reported.Case Presentation: A 49 years-old male patient was admitted to the district hospital with acute febrile illness and a history of traveling to a malaria-endemic area in Borneo, Indonesia. Based on a chest X-ray result, the patient was clinically suspected to have pulmonary tuberculosis. However, the clinical manifestations of leptospirosis i.e. conjunctival suffusion, calf pain, and oliguria were present, and later hemoptysis was also reported. A clinical diagnosis of leptospirosis with pulmonary involvement was proposed. Immunochromatographic test (ICT)-rapid test for vivax/falciparum malaria and Ziehl-Neelsen (ZN) staining of sputum for tuberculosis results were both negative. Microscopic Agglutination Test (MAT), the IgM anti-Leptospira rapid test (lateral flow assay), and PCR amplification of both conventional and real-time (qPCR) were performed using various samples (serum, urine, and sputum). The MAT of acute single serum sample and rapid test were negative. Intriguingly, the PCR showed positive results in sputum and urine samples but not in the serum sample, highlighting the usefulness of leptospiral molecular detection to confirm further diagnosis.Conclusion: Molecular detection of pathogenic Leptospira in sputum samples can be considered for confirmatory diagnosis of leptospirosis patients with pulmonary hemorrhage. Likewise, the urine sample can be used as an option in the examination of severe leptospirosis.
Active Cytomegalovirus Infection in Critically Ill Immunocompeten Patients Admitted in the ICU. A Molecular Diagnosis Approach Minuljo, Tania Tedjo; Gasem, Muhammad Hussein; Hadi, Purnomo
Journal of Biomedicine and Translational Research Vol 3, No 1 (2017): July 2017
Publisher : Faculty of Medicine, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (36.211 KB) | DOI: 10.14710/jbtr.v3i1.866

Abstract

Background: Active Cytomegalovirus (CMV) infection has long been related to immunocompromised conditions such as malignancy, HIV-AIDS, longterm use of corticosteroids and organ transplantation. Nowadays, several studies showed that active CMV infection also frequently found in formerly immunocompetent patients during critically ill condition. Alteration of immune system in critically ill condition might become the most possible reason enderlying this adverse event.Aim: To document the prevalence of active CMV infection in critically ill immunocompetent patient admitted to ICU and to find out the difference of the disease severity between group of patients with and without active CMV infection.Method: This was a cross sectional study. Study conducted from April 1st - June 30th 2013. Subjects were patient aged ≥14 years, hospitalized in the ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Patients who had history of malignancy, HIV-AIDS, use of corticosteroids and organ transplatation were excluded from the study. Disease severity was calculated using APACHE II score in the first 24 hours of ICU admission. EDTA sample for qualitative PCR examination (procedure as described elsewhere) collected after 4 days of ICU admission. Primer for CMV were as follow CMV-F: CATGAAGGTCTTTGCCCAGTAC, CMV-R: GGCCAAAGTGTAGGCTACAATAG. Datas were analyzed using bivariate analysis.Result: Active CMV infection was detected in 16 out of 50 subjects. Mean score of disease severity in all subjects (based on APACHE II scoring system) was 11.8±6.43. Mean score of disease severity in group with active CMV infection was higher than group without active CMV infection, but not differ significantly (12.75 vs. 11.47; p=0,510).Conclusion: The prevalence of active CMV infection in critically ill immunocompetent patient is relatively high (16/50; 32%) in the ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Degree of disease severity might influence the occurance of CMV infection. Qualitative PCR testing was an aqurate tool for diagnosing active CMV infection.
POLA BAKTERI PENYEBAB SEPSIS DAN KEPEKAANNYA TERHADAP ANTIBIOTIK DI RUMAH SAKIT DAERAH GUNUNG JATI PERIODE 1 JANUARI-31 DESEMBER 2022 Ramadhani, Chandra Eka; Gasem, Muhammad Hussein; Indrakusuma, Mohammad Erwin; Amaliah, Nihayatul; Indriyati, Rose
Tunas Medika Jurnal Kedokteran & Kesehatan Vol 10 No 3 (2024): TUNAS MEDIKA JURNAL KEDOKTERAN & KESEHATAN
Publisher : Fakultas Kedokteran UGJ Cirebon

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33603/tumed.v10i3.9617

Abstract

Latar Belakang: Prevalensi 2017 sepsis didunia 48,9 juta dengan mortalitas 11 juta kasus. Pola bakteri penyebabsepsis dan kepekaan antibiotik sangat penting mencegah resistensi dan meningkatnya mortalitas. Tujuan:Mempelajari pola persebaran bakteri dan kepekaannya terhadap antibiotik di Rumah Sakit Daerah (RSD) GunungJati. Metode: Data retrospektif berupa rekam medis, hasil pemeriksaan kultur darah dan uji kepekaan antibiotikdari pasien yang dicurigai sepsis di RSD Gunung Jati selama periode 1 Januari-31 Desember 2022. Penelitiandilaksanakan pada April-Juli tahun 2023. Analisis data dengan World Health Organization (WHO) Net versi 2023sesuai Pedoman Penyusunan Antibiogram Nasional tahun 2022. Hasil: Tiga bakteri terbanyak penyebab sepsisadalah bakteri Gram Negatif; Escherichia coli 26 (24,5%), Klebsiella pneumoniae 18 (17%) dan bakteri GramPositif; Staphylococcus auereus 20 (18,9%). Uji kepekaan antibiotik dengan tingkat Susceptible (≥75 %) padaGram Positif; Amikacin (100%), Linezolid (92%), Rifampicin (87,5%), Vancomycin (84,6%) danTrimethoprim/Sulfamethoxazol (76,2%) sedangkan pada Gram Negatif; Meropenem (96,1%), Ertapenem(89,8%), Amikacin (88,5%) dan Cefepime (76%). Simpulan: Bakteri penyebab sepsis terbanyak adalahEscherichia coli, Stapylococcus aureus dan Klebsiella pneumoniae. Profil kepekaan antibiotik yang baik (≥75 %)pada bakteri Gram Positif; Amikacin, Linezolid, Rifampicin, Vancomycin dan Trimethoprim/Sulfamethoxazolsedangkan pada bakteri Gram Negatif; Meropenem, Ertapenem, Amikacin dan Cefepime.Kata Kunci: Pola Bakteri, Kepekaan Antibiotik, Sepsis