Garuda - Garba Rujukan Digital

p-Index From 2020 - 2025

0.888

P-Index

This Author published in this journals

All Journal SAINS MEDIKA : JURNAL KEDOKTERAN DAN KESEHATAN Jurnal Kedokteran Diponegoro Journal of Biomedicine and Translational Research Indonesian Journal of Biotechnology Herb-Medicine Journal Jurnal Sains Teknologi Akuakultur Jurnal Locus Penelitian dan Pengabdian

Purnomo Hadi

Faculty Of Medicine Diponegoro University

Author-ID : 272221

Aerospace Engineering Agriculture, Biological Sciences & Forestry Automotive Engineering Biochemistry, Genetics & Molecular Biology Decision Sciences, Operations Research & Management Electrical & Electronics Engineering Health Professions Immunology & microbiology Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Public Health

Published : 10 Documents Claim Missing Document

Claim Missing Document

Articles

Molecular Genotyping of HBV by using Nested PCR-RFLP among Hepatitis B Patients in Daerah Istimewa Yogyakarta Province and Surrounding Area Haryanto, Aris; Mulyani, Nenny Sri; Widowati, Titis; Wijayanti, Nastiti; Hadi, Purnomo
Indonesian Journal of Biotechnology Vol 13, No 2 (2008)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (233.942 KB)

Hepatitis B virus (HBV) can be classified into 8 genotypes, genotype A to H. Genotype of HBV is important for clinical and etiological investigations. Research for HBV genotyping, HBV transmission study using nested PCR and HBV genotyping based on RFLP using restriction enzymes have been reported. However, both of those methods have been not applied for HBV genotyping study among hepatitis B patients in endemic area, like Indonesia yet. Molecular genotyping of HBV will describe epidemiology, pathogenesis and clinical implication of HBV. Combination of nested PCR and RFLP (nested PCR-RFLP) method to determine HBV genotype in Indonesia is still less information. The objectives of study were to develop a system for HBV genotyping by nested PCR combined with RFLP (nested PCR-RFLP) method based on nucleotide sequence of surface protein encoding</div><div>gene (S gene) in HBV genome and to confirm HBV genotypes which predominantly found among hepatitis B patients in Daerah Istimewa Yogyakarta Province and surrounding area. Total of 149 sera from chronic hepatitis B patients from Daerah Istimewa Yogyakarta and surrounding areas were collected for in this work. Viral DNA were extracted from sera of hepatitis B patients and used as template for first round nested PCR amplification using outer primers set. Amplicons of first round PCR were used as template for second round amplification using inner primers set. Then, amplicons of second round nested PCR were restriction digested by Sty I and Bsr I enzymes. For HBV genotyping then the restriction products were analyzed by RFLP based on restriction pattern. Results showed that the first round nested PCR amplification generated DNA fragments of whole S gene in length 1.233 bp, and in second round nested PCR amplification using inner primer set generated DNA fragments 585 bp in length. Genotype analysis for all samples using nested PCR-RFLP methods by restriction digested of Sty I and Bsr I enzymes found only 2 HBV genotypes among hepatitis B patients, namely genotype B and C. Quantification</div><div>data showed that most of hepatitis B patients found infected by HBV genotype B (92,8%), genotype C (3,6%) and unidentified genotype (3,6%). Nested PCR-RFLP methods for HBV genotyping is simple and inexpensive for clinical diagnostic in large scale.

UJI BEDA SENSITIVITAS KUMAN NEISSERIA GONORRHOEAE TERHADAP LEVOFLOKSASIN DENGAN TIAMFENIKOL SECARA IN VITRO Budiono, Maria Diandra Christie; Muslimin, Muslimin; Hadi, Purnomo
DIPONEGORO MEDICAL JOURNAL (JURNAL KEDOKTERAN DIPONEGORO) Vol 6, No 2 (2017): JURNAL KEDOKTERAN DIPONEGORO
Publisher : Faculty of Medicine, Diponegoro University, Semarang, Indonesia

Latar belakang: Gonore adalah salah satu infeksi menular seksual yang disebabkan kuman Neisseria gonorrhoeae. Terapi yang digunakan untuk gonore mengalami perubahan karena tingginya angka resistensi antibiotik. Penggunaan antibiotik yang sudah resisten dapat meningkatkan kegagalan terapi, maka dari itu uji sensitivitas antibiotik harus sering dilakukan terutama antibiotik yang menjadi standar terapi, yaitu levofloksasin dan tiamfenikolTujuan: Menilai perbedaan sensitivitas kuman Neisseria gonorrhoeae terhadap levofloksasin dengan tiamfenikol secara in vitro Metode: Penelitian ini merupakan penelitian observasional dengan rancanganCross-sctional design. Sampel adalah biakan kuman Neisseria gonorrhoeae yang didapatkan dari hasil swab endoserviks penderita yang dikonfirmasi melalui pengecatan gram, tes oksidase, uji fermentasi, dan kultur pada media Thayer-Martin Agar. Biakan kuman kemudian diinokulasi pada media Mueller Hinton- Thayer Martin Agar lalu diletakan disk levofloksasin dan kertas saring tiamfenikol dan dilakukan pengukuran zona hambat yang terbentuk dengan penggaris. Masing-masing kelompok penelitian terdiri dari 14 sampel. Uji hipotesis menggunakan uji Chi-squareHasil: Sensitivitas kuman Neisseria gonorrhoeaea terhadap levofloksasin adalah 0% sedangkan terhadap tiamfenikol sensitivitasnya sebesar 71, 43%, dan terdapat perbedaan bermakna antara levofloksasin dengan tiamfenikol ( p <0.05)Simpulan: Terdapat perbedaan bermakna sensitivitas kuman Neisseria gonorrhoeae terhadap levofloksasin dengan tiamfenikol secara in vitro dan sensitivitas kuman Neisseria gonorrhoea terhadap tiamfenikol lebih sensitif daripada levofloksasin.

Pemanfaatan Sari Belimbing Wuluh (Averrhoa bilimbi L.) pada Pemeliharaan Udang Vaname (Litopenaeus vannamei) untuk Menekan Populasi Bakteri Vibrio sp. Koloni Hijau Handayani, Sri; Dwinanti, Sefti Heza; Hadi, Purnomo
Jurnal Masyarakat Akuakultur Indonesia Vol 3, No 1 (2019): In Press
Publisher : Masyarakat Akuakultur Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (423.238 KB)

Sri Handayani, Sefti Heza Dwinanti and Purnomo Hadi. 2020. Utilization of Carambola Sari (Averrhoa bilimbi L.) in the Maintenance of Vaname Shrimp (Litopenaeus vannamei) to Suppress Population of Vibrio sp. Green Colony. Jurnal Sains Teknologi Akuakultur, 3(1) : 33-41. This research was conducted in July-August 2018 at PT. SyAqua Indonesia Serang, Banten. It used Completely Randomized Design (CRD) with three replicates and three treatments which were bilimbi juice in 20 ppm (T1), 30 ppm (T2) and without bilimbi or control (CT). The monitoring of Vibrio sp., defined as total Vibrio sp., totalÂ Â yellow colony, total green colony, the ratio of total green colony, survival rate of shrimp and water quality. The result showed that bilimbi juice was able to suppress the population of Vibrio sp. in the maintenance media and shrimp body. At the end of the maintenance period (d7-d9), total population of green colony in treatment were lower than control with the ratio of the green colony was 0%. In contrast, bilimbi juice with concentration 20 ppm and 30 ppm had no significant effect (P>0,1). The best survival rate was given by T2 about 16% and based on regression y = 0.3589x+5.0279 the optimal dose to protect shrimp from Vibrio sp. by using bilimbi juice is about 264,62 ppm.

THE EFFICACY OF TOPICAL CLINDAMYCIN GEL ON SEVERITY DEGREE OF ACNE VULGARIS AMONG FEMALE COLLEGE STUDENTS Hapsari, Rani Puspita; Widayati, Retno Indar; Afriliana, Liza; Hadi, Purnomo
DIPONEGORO MEDICAL JOURNAL (JURNAL KEDOKTERAN DIPONEGORO) Vol 9, No 4 (2020): DIPONEGORO MEDICAL JOURNAL ( Jurnal Kedokteran Diponegoro )
Publisher : DIPONEGORO MEDICAL JOURNAL (JURNAL KEDOKTERAN DIPONEGORO)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (424.391 KB)

Background: Acne vulgaris is a chronic inflammatory disease in the pilosebaceous follicle of the skin as the result of Propionibacterium acnes colonization. Clindamycin is an antibiotic that is effective against most gram-positive anaerobic bacteria such as the strain of Â Propionibacterium sp. Clindamycin in topical form inhibits P. acnes lipase enzyme resulting in the decrease of free fatty acid on the skin surface and the decrease of the Propionibacterium acnes population. Â Aim: To know the effect of topical clindamycin gel application on the severity degree of acne vulgaris among female college students of Diponegoro University. Methods: The study has done on 34 female college students of Diponegoro University who were diagnosed with Acne Vulgaris. All of the subjects underwent a face skin examination where the acne lesions were counted before and after the treatment. The treatment given was the application of clindamycin topical gel once a day for four weeks. The counted acne lesions were classified into the severity degree of acne vulgaris by Plewig and Kligman. The study compared the severity degree of acne vulgaris before and after the treatment. Statistical analysis of this study used the Wilcoxon test. Result: The result of pre and post-treatment data showed a significant decrease in the severity degree of acne vulgaris after the treatment application (p=0.000). The decrease of severity degree was marked by the decrease of acne lesion count after having four weeks of treatment. This significant result indicated an effective recovery of acne vulgaris after being given the treatment of topical clindamycin. The antibiotic and anti-inflammation effects of clindamycin were discovered effectively healing the lesions of acne vulgaris, therefore, decreasing its severity. Conclusion: Topical clindamycin can effectively reduce the severity degree of acne vulgaris among female college students of Diponegoro University.

Active Cytomegalovirus Infection in Critically Ill Immunocompeten Patients Admitted in the ICU. A Molecular Diagnosis Approach Tania Tedjo Minuljo; Muhammad Hussein Gasem; Purnomo Hadi
Journal of Biomedicine and Translational Research Vol 3, No 1 (2017): July 2017
Publisher : Faculty of Medicine, Diponegoro University

Background: Active Cytomegalovirus (CMV) infection has long been related to immunocompromised conditions such as malignancy, HIV-AIDS, longterm use of corticosteroids and organ transplantation. Nowadays, several studies showed that active CMV infection also frequently found in formerly immunocompetent patients during critically ill condition. Alteration of immune system in critically ill condition might become the most possible reason enderlying this adverse event.Aim: To document the prevalence of active CMV infection in critically ill immunocompetent patient admitted to ICU and to find out the difference of the disease severity between group of patients with and without active CMV infection.Method: This was a cross sectional study. Study conducted from April 1st - June 30th 2013. Subjects were patient aged ≥14 years, hospitalized in the ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Patients who had history of malignancy, HIV-AIDS, use of corticosteroids and organ transplatation were excluded from the study. Disease severity was calculated using APACHE II score in the first 24 hours of ICU admission. EDTA sample for qualitative PCR examination (procedure as described elsewhere) collected after 4 days of ICU admission. Primer for CMV were as follow CMV-F: CATGAAGGTCTTTGCCCAGTAC, CMV-R: GGCCAAAGTGTAGGCTACAATAG. Datas were analyzed using bivariate analysis.Result: Active CMV infection was detected in 16 out of 50 subjects. Mean score of disease severity in all subjects (based on APACHE II scoring system) was 11.8±6.43. Mean score of disease severity in group with active CMV infection was higher than group without active CMV infection, but not differ significantly (12.75 vs. 11.47; p=0,510).Conclusion: The prevalence of active CMV infection in critically ill immunocompetent patient is relatively high (16/50; 32%) in the ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Degree of disease severity might influence the occurance of CMV infection. Qualitative PCR testing was an aqurate tool for diagnosing active CMV infection.

Lung Tuberculosis with Multi Drug Resistant Risk in Tertiary Hospital in Middle Java Ratna Wulan Febriyanti; Winarto Winarto; Mujahidah Mujahidah; Endang Sri Lestari; Purnomo Hadi; Vincentia Rizke Ciptaningtyas
Herb-Medicine Journal: Terbitan Berkala Ilmiah Herbal, Kedokteran dan Kesehatan Vol 4, No 2 (2021): Herb-Medicine Journal April 2021
Publisher : Universitas Muhammadiyah Purwokerto

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30595/hmj.v4i2.10352

World TB report from World Health Organization (WHO) in 2017 informed that Indonesia was second country with TB case. Multi Drug Resistance pulmonary infection’s case in Indonesia were 12.000. Kariadi hospital is one of tertiary hospital for pulmonary MDR-TB treatment but, there is no study about risk factor of it yet, so it needed to find risk factors of MDR-TB pulmonary infection in Kariadi hospital. Cross Sectional design using secondary data from Medical Record from January 1st - December 31, 2017 with result of Mycobacterium tuberculosis on GeneXpert sputum examination. Bivariate analysis with Chi square test and multivariate analysis was done by multiple logistic regression. The p value was considered significant if <0.05, all analyzes were 2-tailed. Totally 110 patients were obtained during periode, 55 samples for case and 55 samples for control. There were correlation between smoking habit OR = 3,1 (CI 95% 1,1-8,7), malnutrition OR = 2,9 (CI 95% 1,3-6,3), contact with patient with MDR pulmonary TB infection OR = 12,0 (CI 95% 1,5-97,3), past treatment OR = 81,7(CI 95% 23,4-285,2) and ≥6months past treatment OR = 94,5 (CI 95% 12,1-736,2. Risk factor that could influence together were contact with patient with MDR pulmonary TB infection OR = 34,5 (CI 95% 2,6-464,5), past treatment OR = 39,4 (CI 95% 8,3-186,3) and ≥ 6months past treatment OR = 12,4 (CI 95% 1,3-117,7). Risk factors for the incidence of pulmonary MDR TB infection are past contact with patient with MDR pulmonary TB infection, past treatment and ≥ 6months past treatment.

The Definitive Diagnosis of Tuberculous Meningitis (TBM) di RSUP dr. Kariadi Semarang Descriptive study in adult patients using IS6110-based PCR amplification for detecting Mycobacterium tuberculosis Masfiyah, Masfiyah; Bintoro, Aris Catur; Hadi, Purnomo
Sains Medika : Jurnal Kedokteran dan Kesehatan Vol 5, No 2 (2013): July-December 2013
Publisher : Fakultas Kedokteran; Universitas Islam Sultan Agung (UNISSULA)

Tuberculous meningitis (TBM) is the most common cause of central nervous system infection and has very high morbidity and mortality. The definitive diagnosis of TBM in RSUP dr Kariadi Semarang has been insufficient. This study aimed at finding out the definitive diagnosis of TBM di RSUP dr Kariadi Semarang using IS6110 sensitive and specific primer. This was a descriptive study included all in-patients with meningitis and/or TBM of RSUP Dr Kariadi Semarang aged > 14 years with Thwaitesâ€™ Diagnostic Score â‰¤ 4 between March 1, 2013 and November, 30 2013. The devinitive diagnosis of TBM was made using IS6110-based PCR amplification for detecting Mycobacterium tuberculosis complex conducted in microbiology clinic of FK UNDIP/RSUP dr. Kariadi Semarang. The secondary data was the basic and laboratory data from the medical records of the patients. Mean age was 39.59 Â± 15.7. Six (35.3%) pasients were diagnosed with devinitive TBM, 3 (17.64%) were meningitis positive by NTM (Non Tuberculous Mycobacteria). Dual infection was found in 1 (5.8%) case between TBM and bacterial meningitis. Most patients were productive age. Some had devititive TBM. The pasient with meningitis and dual infection were also diagnosed with NTM (Non Tuberculous Mycobacteria).

Prevalence of Influenza Viruses (Influenza Like Illness) In Regional Laboratory Avian Influenza Semarang Wahyutomo, Ridha; Ciptaningtyas, V. Rizke; Hadi, Purnomo
Sains Medika : Jurnal Kedokteran dan Kesehatan Vol 3, No 2 (2011): Juli-Desember 2011
Publisher : Fakultas Kedokteran; Universitas Islam Sultan Agung (UNISSULA)

Background: Influenza is the major health threat worldwide causing illness and death every year. However, data on the epidemiology of influenza in tropical countries, including Indonesia, are still limited. Up dated data for its prevalence is needed to monitor its spreading and to evaluate its outbreak. Therefore a working regional laboratory in surveillance of ILI (Influenza Like Illness) was formed. This research was conducted to provide updated data on prevalence of ILI in regional laboratorium avian influenza Semarang.Design and Method: Data from patients examined in the regional laboratory of avian influenza Semarang from April 2009 until December 2010 was collected. Samples were obtained from Malang sentinel, Yogyakarta sentinel and Semarang sentinel. Samples were examined using PCR to detect influenza A, influenza B, and swine flu.Result: out 1367 patients tested, 279 patients (20.41%) were from Yogyakarta sentinel, 619 patients (45.28%) were from Malang sentinel, and 467 patients (34.16%) were from Semarang sentinel. Flu A virus was detected in 117 patients (8.5%). Influenza B virus was found in 39 patients (2.8%). H1 virus was detected in 5 patients (0.36%). H3 virus was detected in 45 patients (3.29%). Swine flu virus was detected in 3 patients in Malang.Conclusion: The highest prevalence of flu A and flu B examined in avian influenza regional laboratory Semarang was from Semarang sentinel, followed by Yogyakarta sentinel and Malang (Sains Medika, 3(2):157-161).

Comparison of SARS-CoV-2 Variant Screening and Whole Genome Sequencing at an Indonesian Tertiary Hospitals Hapsari, Rebriarina; Kesumayadi, Irfan; Sari, Desvita; Anjarwati, Dwi Utami; Alfiyuliani, Nesia Hani; Mujahidah, Mujahidah; Sari, Iva Puspita; Hadi, Purnomo
Journal of Biomedicine and Translational Research Vol 9, No 3 (2023): December 2023
Publisher : Faculty of Medicine, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14710/jbtr.v9i3.19147

Background: The global COVID-19 pandemic, caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), experienced a surge in cases with the emergence of the Omicron variant. Despite increasing vaccination coverage, Indonesia witnessed peaks in COVID-19 cases. Variant screening and whole genome sequencing (WGS) play a crucial role in identifying SARS-CoV-2 variants and monitoring their spread.Objective: The objective of this study was to compare variant screening results with WGS data, assess the prevalence of subvariants, and analyze their correlation with demographic and cycle threshold (CT) values.Methods: Between November 7th and 18th, 2022, variant screening and WGS were conducted on samples with CT values below 30. Variant screening utilized the mBioCov-19+ VarScreen assay, while WGS was performed on the Oxford Nanopore Technologies (ONT) platform. Bioinformatics analysis was performed using epi2melabs. Demographic data and CT values were analyzed. Results: Out of 89 subjects, all tested positive for the Omicron variant through variant screening. The variant screening identified two subvariants: Omicron BA.2 (64%) and Omicron B.1.1.529.1 (36%). WGS revealed that the XBB subvariant was the most dominant (52.8%), followed by BQ.1 (22.5%) and BA.5 (13.5%). When VarScreen indicated BA.2, the majority of WGS results showed XBB (82.5%), while for B.1.1.529.1, the majority of WGS results were BQ.1 (59.4%), followed by BA.5 (37.5%). XBB was the most prevalent variant in both females and males, while BQ.1 was more dominant in females (80%). No infections were detected among children aged 1-5 years. All variants had CT values below 24.Conclusion: Variant screening provides accurate and quick results for detecting the Omicron variant in laboratories without WGS capacity. However, it is important to continuously update the screening methodology based on the prevailing circulating variants. During the study period, XBB emerged as the predominant subvariant of the Omicron variant.

Strategi Peningkatan Pelayanan Kesehatan Melalui Standarisasi Kamar Rawat Inap di RSUD Dolopo Kabupaten Madiun Berdasarkan Pp No. 47 Tahun 2021 Tentang Penyelenggaraan Bidang Perumahsakitan Hadi, Purnomo; Rokhim, Abdul; Muhibbin, Muhammad
Jurnal Locus Penelitian dan Pengabdian Vol. 4 No. 7 (2025): JURNAL LOCUS: Penelitian dan Pengabdian
Publisher : Riviera Publishing

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.58344/locus.v4i7.4588

In January 2014, BPJS Kesehatan launched the National Health Insurance (JKN) program, which brings together several previously fragmented health insurance programs, including Askes (covering public formal sector employees), Jamsostek (private formal sector workers), and Jamkesmas. In the JKN roadmap, Universal Health Coverage (UHC) was expected to be achieved by 2019, but UHC was not achieved until 2024. One of the targets is the same package of medical and non-medical benefits (class of care). This is also stated in Article 23 Paragraph 4 of UU No.40 of 2004 concerning the National Social Security System (SJSN) which mandates standard class treatment for JKN-KIS participants who require hospitalization in the hospital. In July 2023 Madiun Regency will have Universal Health Coverage (UHC) reaching 95.81%. The issuance of PP No. 47 of 2021 concerning Hospital as an implementation of Law No. 11 of 2020 concerning job creation, has an impact on bed rules in hospital inpatient services for JKN participant patients. The abolition of the class-based inpatient concept was replaced by the Standard Inpatient Class (KRIS) service with 12 indicators that must be met according to the Decree of the Director General of Health Services No. HK/02.02/I/1811/2022, where hospitals owned by the central and regional governments must provide at least 60% of all beds as standard inpatient rooms (KRIS). RSUD Dolopo has a capacity of 195 beds, with KRIS hospitalization of 86 TT or only 44% availability. The 44% still does not fulfill 100% of the 12 KRIS criteria. This means that Dolopo Hospital must provide at least an additional 31 TTs. If calculated according to the KRIS standard of 1 room with 4 TT, it means that RSUD Dolopo needs to provide at least 8 inpatient treatment rooms to fulfill the requirement. Based on this research, these obstacles cannot be resolved in a short time. Limitations in budget preparation and in the implementation of development must go through government procurement are obstacles for government hospitals to complete in a short time. In addition, budget availability is often a dilemma for hospitals in prioritizing budget use. In addition to the above, limited human resources in inpatient services are also often a major obstacle. The procurement of employees in government agencies must follow the rules and the number is very limited. In addition, the availability of budget in meeting the qualifications of Human Resources for training is more or less an obstacle. Another obstacle faced by Dolopo Hospital and hospitals in general is inconsistent regulations. There have been three changes in the implementation of the Standard Inpatient Room regulation. Starting in December 2020, it was postponed again on January 1, 2023 and finally on June 30, 2025.

Co-Authors Abdul Rokhim Afriliana, Liza Alfiyuliani, Nesia Hani Ali Djamhuri Aris Catur Bintoro Aris Haryanto Budiono, Maria Diandra Christie Desvita Sari, Desvita Dwi Utami Anjarwati Endang Sri Lestari Hapsari, Rani Puspita Kesumayadi, Irfan Masfiyah Masfiyah, Masfiyah Muhammad Hussein Gasem Muhibbin, Muhammad Mujahidah Mujahidah Mujahidah Mujahidah Nastiti Wijayanti Nenny Sri Mulyani Ratna Wulan Febriyanti Rebriarina Hapsari Retno Indar Widayati Ridha Wahyutomo Sari, Iva Puspita Sefti Heza Dwinanti, Sefti Heza Sri Handayani Tania Tedjo Minuljo Titis Widowati, Titis V. Rizke Ciptaningtyas Winarto Winarto

Title

Found 10 Documents
Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title Search

Found 10 Documents Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title

Found 10 Documents
Search