cover
Contact Name
Kuswanto
Contact Email
rjls@ub.ac.id
Phone
+62341 575825
Journal Mail Official
rjls@ub.ac.id
Editorial Address
Directorate of Research and Community Service, Gedung Layanan Bersama, 7th Floor, Jl. Veteran Malang, Universitas Brawijaya, 65145, Jawa Timur, Indonesia
Location
Kota malang,
Jawa timur
INDONESIA
Research Journal of Life Science
Published by Universitas Brawijaya
ISSN : -     EISSN : 23559926     DOI : https://doi.org/10.21776/ub.rjls
Research Journal of Life Science (RJLS) is an open access publishes papers three times a year that emphasize the agriculture, fisheries, animal science, medicine, basic science and food technology. All articles are rigorously reviewed by reviewers. Articles should be created in a language that is easily understood by non-specialist readers in the topic of the article itself, but interested in research. The main objective of RJLS is to provide a platform for the international scholars, academicians and researchers to share the contemporary thoughts and innovations in the field of life science. RJLS aims to promote studies in life science and so become the leading international journals in life science in the world.This journal intends to provide facilities to advance the development and application of interdisciplinary and transdisciplinary research methodologies in life sciences.
Articles 5 Documents
Search results for , issue "vol 9, no 2 (2022)" : 5 Documents clear
FTIR (Fourier Transform Infrared) Spectroscopy Method for Bacillus cereus Characterization Silfiani, Intan; Abadi, Abdul Latief; Aini, Luqman Qurata; Prillianti, Kestrillia Rega; Prabowo, Matheus Randy; Dianti, Sylvia Herli
Research Journal of Life Science Vol 9, No 2 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.3

Abstract

One of the potentials of Bacillus cereus bacteria is as an inducer of systemic resistance in plants against plant diseases. FTIR spectroscopy is a traditional method extensively utilized in the pharmaceutical industry, since it is fast, non-destructive, and requires minimal sample preparation. In this study, the indicators that were effectively discovered were the functional groups that compose carbohydrates and lipids. The absorption region to be analyzed for the functional groups that compose carbohydrates is in the wavenumber region of 1200-800 cm-1, whereas the functional groups that compose up lipids are in the wavenumber range of 3020-2800 cm-1 and 1800-800 cm-1. The signal produced on the spectral signature of B. cereus isolates revealing the functional groups that compose carbohydrates is at the absorption values of 1185, 1132, 1122, 1098, 1078, 1056, 1010, and 973 cm-1. This is analogous to the notion that the cell wall of B. cereus is composed of peptidoglycan which contains carbohydrates. While the absorption values that indicate the functional groups that make up lipids are 2969, 2955, 2925, 2870, 2846, 1759, 1733, 1471, 1455, 1234, 895 cm-1, which according to the literature suggests that the body structure of B. cereus contains 2-3% of the dry weight of bacterial cells and consists of neutral lipids and phospholipids.
Colony Growth, Sporulation, and Viability of Entomopathogenic Fungus Beauveria bassiana (Balsamo) Vuillemin on Various Agricultural Waste as Growing Media Kurniawan, Irvan; Afandhi, Aminudin; Tarno, Hagus
Research Journal of Life Science Vol 9, No 2 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.4

Abstract

Beauveria bassiana is an entomopathogenic fungus that is widely produced for the benefit of biological control agents of various insect pests. The current production that is expected is to use cheap media but produce quality isolates. This study aims to determine colony growth, sporulation and viability of Beauveria bassiana conidia in several agricultural waste media. The experiment was compiled in a complete randomized design and replicated four times. B. bassiana in rice bran media added with cricket flour  had the fastest colony growth while B. bassiana in rice husk media was the lowest, lower than the control treatment. In  wheat bran media added cricket flour has slower colony growth than rice bran with cricket flour media similar to control treatment but has the second highest sporulation after rice bran with cricket flour media. The highest viability belongs to B. bassiana which is grown on rice bran with cricket flour media. The production in each treatment medium has a real effect but the addition of cricket flour has a significant influence in the production of quality isolates.
Fusarium Rot Biological Control of Citrus caused by Fusarium oxysporum Dewi, Ovilya Kusuma Minarma; Abadi, Abdul Latief; Widyaningsih, Sri
Research Journal of Life Science Vol 9, No 2 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.5

Abstract

Fusarium oxysporum is a pathogen that causes Fusarium rot disease on citrus plants. The F. oxysporum is a soil-borne pathogen whose fungicide is not effective against it and difficult to cure. Thus, the use of Trichoderma spp. as one of the most effective and well-known biocontrol agents against many plant diseases in agriculture is needed. To test Trichoderma capabilities on the specific pathogen, method of this study consisted of isolation and rejuvenation of F. oxysporum and Trichoderma, morphological identification of the fungus, in vitro test of Trichoderma antagonistic ability against F. oxysporum on PDA medium, and in vivo test conducted in a green house on Rough Lemon (RL) and Japansche Citroen (JC) rootstock seeds to calculate the total disease incidence using a formula. The result of in vitro test of this study shows that 3 Trichoderma isolates (TJ, TKH, and TST) were able to inhibit the growth of F. oxysporum on PDA medium by 65.56%, 62.99%, and 61.19%, respectively. While in vivo test shows that the treatment of TJ isolates on RL seeds and TKH on JC seeds shows lowest disease incidence percentage of 3.33%. Therefore, this study proves that Trichoderma can be used as a biocontrol agent in controlling Fusarium rot disease in citrus plants. However, further research is needed to detect which Trichoderma species TJ and TKH isolates contain.
Induction Resistance in Chili (Capsicum frutescens L.) to the Geminivirus Disease by Pseudomonas fluorescens Saidi, Aluna Uthilma; Martosudiro, Mintarto; Abadi, Abdul Latief
Research Journal of Life Science Vol 9, No 2 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.1

Abstract

This study included resistance induced by Pseudomonas fluorescens PGPR in chili (Capsicum frutescens L.) infected with Geminivirus. Geminivirus often attacks chili plants, causing disease with a yellowish color to the leaves, lobes, and stunting. Chili plants that have been attacked by the virus will experience crop failure and plant death. Virus prevention can be done with the application of PGPR by Pseudomonas fluorescens. The method used was 6 treatments on chili plants which were repeated 4 times. The analysis of variance was processed using R software. The results showed that cayenne pepper plants that were given the PGPR application had a shorter incubation period against Geminivirus attacks. Each concentration of Pseudomonas fluorescens has a mean incubation period that is not significantly different. The results also showed that there was a significant difference in the intensity of the disease that attacked the cayenne pepper plant. The application of 107 Pseudomonas fluorescens showed the most optimal results for phenol content, plant height, and number of plant leaves. The application of 109 Pseudomonas fluorescens showed optimal results for the content of IAA and the content of the peroxidase enzyme.
Characterization of Ralstonia solanacearum Using Fourier Transform Infrared (FTIR) Spectroscopy Ma'alifah, Nur; Aini, Luqman Qurata; Abadi, Abdul Latief; Prillianti, Kestrilia Rega; Prabowo, Matheus Randy
Research Journal of Life Science Vol 9, No 2 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.2

Abstract

Ralstonia solanacearum, the causal agent of bacterial wilt disease is worldwide in distribution, and results in serious economic losses, particularly in the tropics. Detection and characterization of microorganisms by Fourier transform infrared spectroscopy (FTIR) technique promises to be of great value because of the method’s inherent sensitivity, small sample size, rapidity, and simplicity. In this study, we used FTIR spectroscopy for the characterization of Ralstonia solanacearum. The bacteria were grown on Nutrient Agar (NA) at 28°C for 48 hours. The colonies of Ralstonia solanacearum on nutrient agar medium were smooth circular, raised, and dirty white. Cultures of bacteria were identified by molecular methods using PCR techniques. The DNA was amplified using a specific primer pair, 759f/760r (forward primer: 5'- GTCGCCGTCAACTCACTTTCC 3’, reverse primer: 5'-GTCGCCGTAGCAATGCGGAATCG-3’). The PCR produced a single band of 280 bp from the isolated DNA of cultured bacteria.  Bacterial spectra were obtained in the wavenumber range of 4000–400 cm-1 using FTIR spectroscopy. The identification of cell wall constituents in region 3000–2800 cm-1, the proteinaceous structure of bacteria in region 1665–1200 cm-1, and the fingerprint of bacteria in region 1200-800 cm-1 are all part of the spectra analysis in this study. Absorption bands obtained from bacteria Ralstonia solanacearum samples associated with protein, phospholipids, nucleic acids, and carbohydrates appear in the bacterial IR absorption spectra.

Page 1 of 1 | Total Record : 5