Article Per Year (5 Year)
p-Index From 2020 - 2025
1.006
P-Index
This Author published in this journals
All Journal Research Journal of Life Science Indonesian Journal of Natural Pigments
Prabowo, Matheus Randy
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemistry Medicine & Pharmacology Other

Published : 6 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 6 Documents
Search

 1 
Characterization of Tambjamines Pigment from Marine Bacterium Pseudoalteromonas sp. PM2 Indigenous from Alor Island, Indonesia Setiyono, Edi; Adhiwibawa, Marcelinus Alfasisurya Setya; Prabowo, Matheus Randy; Brotosudarmo, Tatas H.P.
Indonesian Journal of Natural Pigments Vol 3 No 1 (2021): February 2021
Publisher : Ma Chung Research Center for Photosynthetic Pigments

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33479/ijnp.2021.03.1.16-23

Abstract

Pigments from marine bacteria have attracted the attention for scientists because of their extensive applications and currently exploration of new pigment sources from marine bacteria is still ongoing. Recently, we have successfully isolated six new yellow-pigmented marine bacteria, strain PS2, PM2, SB11, SB13, SB21, and SB23, isolated from seawater from different sampling sites on Alor Island, Indonesia. The UV−Vis and FTIR spectra of the crude pigment extracts of the six strains showed the characteristics of tambjamines, a group of yellow pigments commonly found in nudibranchs and bryozoans. Moreover, separation and characterization of crude tambjamines extract resulted in five different types of tambjamine with maximum absorbance at the wavelength of 374−392 nm. Based on the analysis of 16S rRNA gene sequences, strain PM2 was closely related to several species in genus Pseudoalteromonas with a similarity of more than 99%. Strain PM2 was designed as Pseudoalteromonas sp. PM2 with accession number LC505058. So far, only two marine bacteria have been known to produce tambjamine and they are from genus Pseudoalteromonas. Our new finding indicated that in the group of marine bacteria, tambjamine might be only synthesized by members from genus Pseudoalteromonas.
Identification of Aflatoxigenic Fungi in Myristica fragrans using V8 and CAM Media Arifah, Fitri; Aini, Luqman Qurata; Muhibuddin, Anton; Dianti, Sylvia; Prabowo, Matheus Randy
Research Journal of Life Science Vol 9, No 3 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.03.3

Abstract

Nutmeg is a spice that might be susceptible to being infected with aflatoxigenic fungi. Aflatoxins are mycotoxins synthesized by certain strains of Aspergillus section Flavi. However, not all strains are able to produce aflatoxins. The approach frequently employed for this survey comprises the cultivation of strains in a suitable liquid or solid medium and their subsequent extraction and analysis for the presence of aflatoxins. To date, very few studies have been conducted on the identification of contaminate and aflatoxigenic fungi in Myristica fragrans. Therefore, this study aimed to identify the contaminate and aflatoxigenic fungi in Myristica fragrans growing on V8 and CAM Media. Isolation of the fungus was carried out by direct agar plating. Lasiodiplodia theobromae, Aspergillus niger, A. tamarii, Penicillium citrinum, Rhizopus delemar, A. nomiae, and A. aflatoxiformans were recovered from nutmeg kernels sampled from North Minahasa, North Sulawesi, Indonesia. The findings of fungal isolation demonstrated that L. theobromae was the most prevalent form of fungus detected in the nutmeg kernels (50%), followed by A. niger (38.13%) and A. tamarii (10%). A. nomiae and A. aflatoxiformans were the aflatoxigenic fungi isolated from M. fragrans kernels.
Characterization of Ralstonia solanacearum Using Fourier Transform Infrared (FTIR) Spectroscopy Ma'alifah, Nur; Aini, Luqman Qurata; Abadi, Abdul Latief; Prillianti, Kestrilia Rega; Prabowo, Matheus Randy
Research Journal of Life Science Vol 9, No 2 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.2

Abstract

Ralstonia solanacearum, the causal agent of bacterial wilt disease is worldwide in distribution, and results in serious economic losses, particularly in the tropics. Detection and characterization of microorganisms by Fourier transform infrared spectroscopy (FTIR) technique promises to be of great value because of the method’s inherent sensitivity, small sample size, rapidity, and simplicity. In this study, we used FTIR spectroscopy for the characterization of Ralstonia solanacearum. The bacteria were grown on Nutrient Agar (NA) at 28°C for 48 hours. The colonies of Ralstonia solanacearum on nutrient agar medium were smooth circular, raised, and dirty white. Cultures of bacteria were identified by molecular methods using PCR techniques. The DNA was amplified using a specific primer pair, 759f/760r (forward primer: 5'- GTCGCCGTCAACTCACTTTCC 3’, reverse primer: 5'-GTCGCCGTAGCAATGCGGAATCG-3’). The PCR produced a single band of 280 bp from the isolated DNA of cultured bacteria.  Bacterial spectra were obtained in the wavenumber range of 4000–400 cm-1 using FTIR spectroscopy. The identification of cell wall constituents in region 3000–2800 cm-1, the proteinaceous structure of bacteria in region 1665–1200 cm-1, and the fingerprint of bacteria in region 1200-800 cm-1 are all part of the spectra analysis in this study. Absorption bands obtained from bacteria Ralstonia solanacearum samples associated with protein, phospholipids, nucleic acids, and carbohydrates appear in the bacterial IR absorption spectra.
Fourier Transform Infra-Red (FTIR) Spectrum Characterization of Bacillus mycoides Trisnawati, Luh Putu Adi; Aini, Luqman Qurata; Abadi, Abdul Latief; Prillianti, Kestrillia Rega; Prabowo, Matheus Randy
Research Journal of Life Science Vol 9, No 3 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.03.2

Abstract

The presence of Bacillus mycoides and its ability to grow and spread quickly certainly affect the growth of the target pathogen and it can cause invalid detection results. Therefore, the presence of contaminant bacteria needs to be detected to ensure the specificity of the detection results against the target pathogenic bacteria. Various kinds of detection methods are commonly used, such as ELISA (enzyme-linked immunosorbent assay) and PCR (polymerase chain reaction) are time-consuming and not always very specific. Fourier-transform infrared (FTIR) spectroscopy methods were adopted to provide a comprehensive and reliable method for bacterial analysis. In this study, FTIR spectroscopy was used as an initial guess for the identification of bacterial isolates. Our results showed that there are dominant peaks from the FTIR spectrum obtained that were most associated with protein and carbohydrate in the range of wave number 400-4000 cm-1.  
Fourier Transform Infrared (FTIR) Spectroscopy Method for Fusarium solani Characterization Hasanah, Ifa Maulidah; Martosudiro, Mintarto; Aini, Luqman Qurata; Prillianti, Kestrilia Rega; Prabowo, Matheus Randy
Research Journal of Life Science Vol 9, No 1 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.01.3

Abstract

The detection and identification of microorganisms using spectroscopy techniques promise to be of great value because of their sensitivity, rapidity, low expense, and simplicity.  In this study, we used FTIR spectroscopy for the characterization of Fusarium solani. PCR amplification of DNA extracted from these isolates showed the possibility of amplifying PCR products with sizes 559 bp using the ITS1-ITS4 primers. Based on phylogenetic tree analysis, the isolate of F. solani showed a closely relationship to Fusarium solani isolate MN (MH300495.1) with 99.63% similarity.  The study is focused on the carbohydrate structure which can be analyzed in the range of 900 to 1200 cm-1 of FTIR wavenumber.  The spectra of our samples share similarities with one another, although small differences occur in the absorbance value. The band at 1027 cm-1 is assigned to the C-O stretching of glycogen. Meanwhile, at 1042 cm-1 is interpreted as carbohydrate C-O stretching as well. The band around 1073 cm-1 might arise from both chitin C-C stretching and phosphate stretching of nucleic acids. Other vibrations associated with chitin are also found at 1115 cm-1 and 1151 cm-1 which are assigned to C-O-C symmetric stretching and C-O-C asymmetric stretching, respectively.
FTIR (Fourier Transform Infrared) Spectroscopy Method for Bacillus cereus Characterization Silfiani, Intan; Abadi, Abdul Latief; Aini, Luqman Qurata; Prillianti, Kestrillia Rega; Prabowo, Matheus Randy; Dianti, Sylvia Herli
Research Journal of Life Science Vol 9, No 2 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.3

Abstract

One of the potentials of Bacillus cereus bacteria is as an inducer of systemic resistance in plants against plant diseases. FTIR spectroscopy is a traditional method extensively utilized in the pharmaceutical industry, since it is fast, non-destructive, and requires minimal sample preparation. In this study, the indicators that were effectively discovered were the functional groups that compose carbohydrates and lipids. The absorption region to be analyzed for the functional groups that compose carbohydrates is in the wavenumber region of 1200-800 cm-1, whereas the functional groups that compose up lipids are in the wavenumber range of 3020-2800 cm-1 and 1800-800 cm-1. The signal produced on the spectral signature of B. cereus isolates revealing the functional groups that compose carbohydrates is at the absorption values of 1185, 1132, 1122, 1098, 1078, 1056, 1010, and 973 cm-1. This is analogous to the notion that the cell wall of B. cereus is composed of peptidoglycan which contains carbohydrates. While the absorption values that indicate the functional groups that make up lipids are 2969, 2955, 2925, 2870, 2846, 1759, 1733, 1471, 1455, 1234, 895 cm-1, which according to the literature suggests that the body structure of B. cereus contains 2-3% of the dry weight of bacterial cells and consists of neutral lipids and phospholipids.
Co-Authors Abdul Latief Abadi Adhiwibawa, Marcelinus Alfasisurya Setya Anton Muhibuddin Arifah, Fitri Dianti, Sylvia Dianti, Sylvia Herli Edi Setiyono Hasanah, Ifa Maulidah Kestrilia Rega Prilianti Luqman Qurata Aini Ma'alifah, Nur Mintarto Martosudiro Prillianti, Kestrillia Rega Silfiani, Intan Tatas H.P. Brotosudarmo Trisnawati, Luh Putu Adi