Article Per Year (5 Year)
p-Index From 2020 - 2025
1.066
P-Index
This Author published in this journals
All Journal HAYATI Journal of Biosciences Jurnal Gizi dan Pangan Sabda: Jurnal Kajian Kebudayaan Journal of Marine Research Jurnal Kelautan Tropis Journal of Tropical Biodiversity and Biotechnology
Sibero, Mada Triandala
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Earth & Planetary Sciences Education Environmental Science Health Professions Immunology & microbiology

Published : 7 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 7 Documents
Search

 1 
TRADISI MERDANG MERDEM KALAK KARO DI DESA JUHAR, KECAMATAN JUHAR, KABUPATEN KARO, SUMATERA UTARA Sibero, Mada Triandala; Sibero, Diandala
Sabda: Jurnal Kajian Kebudayaan Vol 12, No 1: 2017
Publisher : Fakultas Ilmu Budaya Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (462.273 KB) | DOI: 10.14710/sabda.12.1.91-100

Abstract

Juhar village is located in Subdistrict Juhar, District Karo, North Sumatera. Majority of society in Juhar village are farmers and cattlemen. A few of farmers farm in the forest and collect forest products. The society do the traditional ceremony known as merdang merdem and also known as kerja tahun. Merdang merdem in Juhar Village is organized by youth and held every year on August 17th. Merdang merdem was held as thanksgiving to the ancestral spirits for the success and good harvest. Today, merdang merdem is held for family gathering. In this event, there are traditional performances like rende and landek
Identifikasi Molekuler Kapang Asosiasi Spons menggunakan Metode DNA Barcoding Larasati, Stefanie Jessica Henny; Sabdono, Agus; Sibero, Mada Triandala
977-2407769
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14710/jmr.v10i1.28334

Abstract

Spons merupakan organisme yang memiliki pori-pori dan termasuk kedalam filum Porifera. Hewan ini merupakan filter feeders dimana spons menyaring makanannya masuk kedalam rongga tubuhnya, sehingga spons dapan memakan partikel organik algae, dan mikroba, termasuk kapang. Kapang merupakan mikroorganisme eukariotik dari kingdom fungi, multiseluler, menghasilkan miselium tanpa pembentukan badan buah. Kapang dapat berfungsi sebagai penjaga keseimbangan ekosistem di perairan. Tujuan dari penelitian ini adalah mengidentifikasi dua isolat kapang yang telah diisolasi dari inang spons di ekosistem mangrove dengan menggunakan DNA barcoding. Metode dalam penelitian ini yaitu peremajaan isolat, karakterisasi morfologi yaitu warna koloni, tekstur, reverse, exudates, sclerotia, bentuk konidia, konidiofor, spora, dan septa. Identifikasi molekuler dari ekstraksi DNA, amplifikasi, elektroforesis, visualisasi DNA, sekuens dan BLAST. Optimasi suhu annealing dilakukan pada amplifikasi DNA. Berdasarkan identifikasi molekuler dengan menggunakan primer universal ITS1 5' TCCGTAGGTGAACCTGCGG 3' dan ITS4 5' TCCTCCGCTTATTGATATGC 3' dan persamaan homologi, isolat MKMS 2.1 merupakan Trichoderma reesei (100%) dan PKMS 2.2 merupakan spesies Fusarium solani (99,81%). A sponge is an organism that has pores and belongs to the Porifera phylum. These animals are filter feeders where the sponge filters its food into the body cavity, so the sponge can eat organic algae particles, and microbes, including fungi. Mold is a eukaryotic microorganism from Fungi kingdom, multicellular, that forms mycelium without fruiting body formation. Mold has an important role in balancing the environmental quality in an ecosystem. The purpose of this study was to identify two molds that had been isolated from sponge in the mangrove ecosystem using DNA barcoding. The study was conducted in April-October 2019 in Laboratory of Tropical Marine Biotechnology using the experimental laboratory method. The methods in this research were isolation refreshment, morphological characterization which were consisted of colony color, texture, reverse, exudates, sclerotia, conidia, conidiophores, spores, and septa. Molecular identification consisted of DNA extraction, amplification, electrophoresis, DNA visualization, sequences and BLAST. Annealing temperature optimization is carried out on DNA amplification. Based on molecular identification using universal primers ITS1 5 'TCCGTAGGTGAACCTGCGG 3' and ITS4 5 'TCCTCCGCTTATTGATATGC 3' and homological equations, MKMS 2.1 isolates were identified as Trichoderma reesei (100%) and PKMS 2.2 were identified as Fusarium solani (99.81%).
Kandungan Senyawa Bioaktif dan Aktivitas Biologis Daun Mangrove Lumnitzera racemosa di Pantai Teluk Awur dan Pantai Blebak Jepara Dewi, Melati Sukma; Tri Nuraini, Ria Azizah; Yulianto, Bambang; Sibero, Mada Triandala
Journal of Marine Research Vol 12, No 3 (2023): Journal of Marine Research
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14710/jmr.v12i3.34584

Abstract

Lumnitzera racemosa tumbuh luas di hutan bakau di daerah tropis, menjanjikan potensi sumber daya untuk digunakan manusia sebagai bahan farmakalogi dari senyawa bioaktif yang terkandung di dalamnya. Penelitian sebelumnya menunjukkan ekstrak L. racemosa berpotensi sebagai antimikroba, antihipertensi, anti diare, dan antioksidan. Tujuan penelitian ini adalah untuk mengetahui karakteristik senyawa bioaktif dan juga mengetahui aktivitas antibakteri dan antioksidan pada ekstrak daun mangrove L. racemosa asal Pantai Teluk Awur dan Pantai Blebak, Jepara, Jawa Tengah. Metode ekstraksi menggunakan maserasi bertingkat dengan tiga pelarut berbeda berdasarkan kepolarannya. Uji fitokimia dan Analisa Metabolite Finger Printing dengan TLC (Thin Layer Chromatography) dilakukan untuk mengetahui senyawa bioaktif yang terkandung dalam daun mangrove L. racemosa, untuk mengetahui aktivitas biologis yaitu aktivitas antibakteri digunakan metode agar well dengan menggunakan empat bakteri MDR (Multi Drug Resistance), sedangkan uji aktivitas antioksidan menggunakan metode DPPH (2,2-difenil-1-pikrilhidrazil). Hasil uji fitokimia menujukkan senyawa bioaktif ekstrak daun L. racemosa yang meliputi alkaloid, flavonoid, fenol hidrokuinon, dan steroid. Analisa Metabolite Finger Printing dengan uji TLC menunjukkan senyawa bioaktif yang terkandung antara lain: terpenoid, fenol, dan alkaloid dan positif menunjukkan aktivitas antioskidan. Aktivitas antibakteri, menunjukkan hasil negatif yaitu tidak terbentuknya zona hambat pada ke empat bakteri. Aktivitas antioksidan dilihat dari nilai IC50 daun L. racemosa Pantai Teluk Awur menujukkan nilai IC50 paling baik adalah ekstrak metanol 161,606 ppm (lemah) sedangkan pada lokasi Pantai Blebak menunjukkan nilai IC50 yang berpotensial pada ekstrak etil asetat 17,441 ppm (sangat kuat). Daun mangrove L. racemosa Pantai Teluk Awur dan Pantai Blebak memiliki potensi untuk bidang farmakologi dilihat dari hasil aktivitas senyawa bioaktif yang terkandung dalam daun L. racemosa. Lumnitzera racemosa grows widely in mangrove forests in the tropics, promising potential resources for pharmaceutical ingredients from the bioactive compounds contained in it. Previous studies have shown the extract may have biological activities such as antimicrobial, antihypertensive, antidiarrheal, and antioxidant. The purpose of this study was to determine the bioactive antibacterial compounds and also to determine the activity and antioxidants in the extract of the mangrove leaves of L. racemosa from Teluk Awur Beach and Blebak Beach, Jepara, Central Java. The extraction method uses graded maceration with three different solvents based on their polarity. Phytochemical tests and Metabolite Finger Printing Analysis with Thin Layer Chromatography (TLC) tests were carried out to determine the bioactive compounds contained in the mangrove leaves of L. racemosa, to determine the biological activity, namely the antibacterial activity used by the agar method using four MDR (Multi-Drug Resistance) bacteria, while the activity test antioxidant using the DPPH method (2,2-diphenyl-1-picrylhydrazyl). The results of the phytochemical test showed that the bioactive compounds of L. racemosa leaf extract included: alkaloids, flavonoids, phenol hydroquinone, and steroids. Metabolite Finger Printing Analysis with Thin Layer Chromatography (TLC) test showed that the bioactive compounds contained include terpenoids, phenols, and alkaloids and positively indicated antioxidant activity. Antibacterial activity showed negative results, namely no inhibition zone was formed on bacterial empathy. Antioxidant activity seen from the IC50 value of L. racemosa leaves showed the best IC50 value was methanol extract 161,606 ppm (weak) while at Blebak Beach location showed possible IC50 value in ethyl acetate extract 17,441 ppm (very strong). The mangrove leaves of L. racemosa Teluk Awur Beach and Blebak Beach have potential in the field of pharmacology seen from the results of the activity of bioactive compounds contained in the leaves of L. racemosa leaves.
First Report on Wild Occurrences of Phoenix Mushroom (Pleurotus pulmonarius Fr. Quél.) in Indonesia Putra, Ivan Permana; Nurhayat, Oktan Dwi; Sibero, Mada Triandala; Hermawan, Rudy
Journal of Tropical Biodiversity and Biotechnology Vol 9, No 1 (2024): March
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jtbb.86455

Abstract

The genus Pleurotus is known as a commercially important mushroom and one of the most well-known cultivated mushrooms worldwide. Of many species of Pleurotus, the phoenix mushroom (P. pulmonarius) is cultivated in many countries, including Indonesia. In Indonesia, the farmers and larger companies usually use commercial strains of phoenix mushroom which they purchased from other countries. To date, there was no prior information regarding wild occurrences of P. pulmonarius in Indonesia. During our regular mushroom hunting in Sukabumi, West Java, Indonesia, some edible wild fruiting bodies of light brown Pleurotus were collected. The current study aimed to determine the taxonomical position of our specimens based on morphological and molecular evidence. The combination of morphological and molecular analysis confirmed our specimens as P. pulnonarius. Morphologically, our specimens were distinguished by the small to medium sized fruiting bodies, pileus light brown, pinkish brown, to pale brown, flabelliform in the beginning to expanding broadly ovoid in maturity, lamellae shortly to deeply decurrent, stipe fleshy, eccentric to lateral, concolorous with lamellae, Basidiospores cylindrical to ellipsoid, basidia clavate to club shaped, basidioles are abundant, oleiferous hyphae common. The BLAST result revealed that our specimens posed a high similarity to P. pulnonarius from several countries as the top hits. The ITS phylogenetic tree placed Pleurotus FIPIA-DEP51 in the same clade of P. pulnonarius with 100% BS value. This study reports for the first time the wild occurences of P. pulmonarius in Indonesia. Future study should be done to characterize the cultures of reported mushroom which can potentially be the local strain for cultivation of P. pulmonarius industry in Indonesia. 
The Unpopular Edible Bolete (Phlebopus portentosus) in Indonesia Putra, Ivan Permana; Nurhayat, Oktan Dwi; Sibero, Mada Triandala; Hermawan, Rudy; Kristanto, Michael Aditya
HAYATI Journal of Biosciences Vol. 31 No. 4 (2024): July 2024
Publisher : Bogor Agricultural University, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.4308/hjb.31.4.663-670

Abstract

Phlebopus portentosus (Berk. and Broome) Boedijn was firstly constructed from the collection of Indonesia in 1951. To date, the subsequent collection of this ectomycorrhizal (ECM) fungi has not been done in Indonesia. In addition, the utilization information of this edible mushroom as food is not popular for the country. The goal of our work was to update the current collection, provide the morphological and molecular data, and promote the utilization of this edible mushroom in Indonesia. Fresh fruiting bodies were evaluated for morphological and molecular evidence. The basidiomata were analysis on the basis of the morphological and molecular evidence. The phylogenetic tree was constructed following the rDNA-ITS 1/2 sequence. P. portentosus was verified by morphological and phylogenetic studies combined. The indigenous people in the research site use this wild edible mushroom for self-consumption and sell it to local market. Phlebopus portentosus BO24626 was solitary to connate, boletoid basidioma, yellowish to greenish brown pileus and stipe, yellowish hymenophore, clavate stipe, club shaped basidia, oval to subglobose basidiospores, cystidia present. The absence of sponge-like tissues and the occurrence of sterigmata distinguished our specimens from the similar morphological species P. spongious. The lack of reddish stipe distinguished our specimen from P. roseus. In addition, the presence of hymenial cystidia delimits our specimens from P. colossus. The inferred phylogenetic tree nested our specimen in the group of P. portentosus (sister to P. spongiosus). The ITS sequence of our specimen is now deposited at GenBank and can be applied to upcoming research of P. portentosus.
Potensi Metabolit Kapang Endofit Mangrove Rhizophora apiculata sebagai Anti-Staphylococcus epidermidis Limbong, Maria Fransiska; Setyati, Wilis Ari; Sedjati, Sri; Sibero, Mada Triandala
Jurnal Kelautan Tropis Vol 27, No 1 (2024): JURNAL KELAUTAN TROPIS
Publisher : Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14710/jkt.v27i1.20133

Abstract

Mangrove association molds are known to produce secondary metabolite compounds that have antibacterial activity. The purpose of this study was to obtain anti-Staphylococcus epidermidis metabolites produced by the endophytic mold of mangrove Rhizophora apiculate. The screening process is carried out in exploratory descriptive research.  The stages of this research are sampling, mold isolation and purification, and macroscopic characterization. Initial screening of antibacterial activity is carried out by the agar plug method. Isolates that produce antibacterial metabolites are molecularly identified. The isolate was then cultured with Potato Dextrose Agar (PDA) media. The producing antibacterial metabolites were extracted using two solvents of different polarities (ethyl acetate and methanol) by stratified maceration method. Antibacterial metabolites are then tested to determine the concentration of extracts required to inhibit (Minimum Inhibitory Concentration (MIC) and kill bacterial growth (Minimum Bactericidal Concentration / MBC). The results of this study showed that there is one species of mangrove endophytic mold Rhizophora apiculata that can produce antibacterial metabolites against S. epidermidis, namely Diaporthe sennae.  These antibacterial metabolites are present in ethyl acetate extract. The resulting bioactivity based on the ability to inhibit bacterial growth can be seen from the MIC value of 2.5 mg / mL and the ability to kill bacteria with an MBC value of 5 mg / mL. The mold metabolite Diaporthe sennae could potentially be developed as an anti-Staphylococcus epidermidis  Kapang asosiasi mangrove diketahui menghasilkan senyawa metabolit sekunder yang memiliki aktivitas antibakteri. Tujuan penelitian ini adalah untuk mendapatkan metabolit anti-Staphylococcus epidermidis yang dihasilkan oleh kapang endofit mangrove Rhizophora apiculate. Proses skrining dilakukan secara diskriptif eksploratif.  Tahapan penelitian ini adalah pengambilan sampel, isolasi dan purifikasi kapang, serta karakterisasi makroskopis. Skrining awal aktivitas antibakteri dilakukan dengan metode agar plug. Isolat yang menghasilkan metabolit antibakteri diidentifikasi secara molekuler. Isolat tersebut selanjutnya dikultur dengan media Potato Dextrose Agar (PDA). Metabolit antibakteri yang dihasilkan diekstraksi menggunakan dua pelarut yang berbeda polaritas (etil asetat dan metanol) dengan metode maserasi bertingkat. Metabolit antibakteri kemudian diuji untuk menentukan konsentrasi ekstrak  yang diperlukan untuk menghambat (Minimum Inhibitory Concentration /MIC) dan membunuh pertumbuhan bakteri (Minimum Bactericidal Concentration /MBC). Hasil penelitian ini menunjukkan bahwa terdapat satu spesies kapang endofit mangrove Rhizophora apiculata yang yang dapat menghasilkan metabolit antibakteri  melawan S. epidermidis, yaitu Diaporthe sennae.  Metabolit antibakteri tersebut terdapat dalam ekstrak etil asetat. Bioaktivitas yang dihasilkan berdasarkan kemampuan menghambat pertumbuhan bakteri terlihat dari nilai MIC sebesar 2,5 mg/mL dan kemampuan membunuh bakteri dengan nilai MBC sebesar 5 mg/mL.  Metabolit kapang Diaporthe sennae berpotensi dikembangkan sebagai anti-Staphylococcus epidermidis 
Dietary Diversity, Stunting, and the Impact of an Education Program on Parents’ Knowledge and Attitudes in West Sumba, Indonesia Hendryanti, Dea Nathania; Andriani, Cynthia; Indriani, Sylvia; Gunawan, Lidyawati; Sibero, Mada Triandala
Jurnal Gizi dan Pangan Vol. 18 No. 2 (2023)
Publisher : The Food and Nutrition Society of Indonesia in collaboration with the Department of Community Nutrition, IPB University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25182/jgp.2023.18.2.79-88

Abstract

This pre- and post-test quasi-experimental study aimed to assess dietary diversity and its association with stunting among toddlers (13–60 months), examine the levels of knowledge and attitudes towards balanced and diverse diets among parents or caregivers, and evaluate the impact of customized flashcards and meal boxes as educational tools on parents’/caregivers’ knowledge and attitudes in three selected villages in West Sumba, Indonesia. A total of 59 parents/caregivers were recruited, 30% of whom had stunted toddlers. The levels of parents’/caregivers’ knowledge and attitudes were moderate. The results from the pre-test study show that Dietary Diversity Score (DDS) did not correlate with stunting status. Furthermore, neither knowledge nor attitudes was discovered to be related to DDS. The use of flashcards and meal boxes in the educational program improved the scores of knowledge (p<0.05) and attitudes (p<0.05) from the pre-test scores. There was a positive correlation between knowledge and attitudes, either before or after the education program (r=0.362, p<0.05 and r=0.562, p<0.05, respectively). To summarize, this study has the potential to be applied in other rural and remote areas.
Co-Authors Agus Sabdono Andriani, Cynthia Bambang Yulianto Dewi, Melati Sukma Gunawan, Lidyawati Hendryanti, Dea Nathania Ivan Permana Putra Kristanto, Michael Aditya Larasati, Stefanie Jessica Henny Limbong, Maria Fransiska Nurhayat, Oktan Dwi Ria Azizah Tri Nuraini Rudy Hermawan Sibero, Diandala Sri Sedjati Sylvia Indriani Wilis Ari Setyati