Claim Missing Document
Check
Articles

Found 2 Documents
Search
Journal : journal of marine research

Identifikasi Molekuler Kapang Asosiasi Spons menggunakan Metode DNA Barcoding Larasati, Stefanie Jessica Henny; Sabdono, Agus; Sibero, Mada Triandala
977-2407769
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14710/jmr.v10i1.28334

Abstract

Spons merupakan organisme yang memiliki pori-pori dan termasuk kedalam filum Porifera. Hewan ini merupakan filter feeders dimana spons menyaring makanannya masuk kedalam rongga tubuhnya, sehingga spons dapan memakan partikel organik algae, dan mikroba, termasuk kapang. Kapang merupakan mikroorganisme eukariotik dari kingdom fungi, multiseluler, menghasilkan miselium tanpa pembentukan badan buah. Kapang dapat berfungsi sebagai penjaga keseimbangan ekosistem di perairan. Tujuan dari penelitian ini adalah mengidentifikasi dua isolat kapang yang telah diisolasi dari inang spons di ekosistem mangrove dengan menggunakan DNA barcoding. Metode dalam penelitian ini yaitu peremajaan isolat, karakterisasi morfologi yaitu warna koloni, tekstur, reverse, exudates, sclerotia, bentuk konidia, konidiofor, spora, dan septa. Identifikasi molekuler dari ekstraksi DNA, amplifikasi, elektroforesis, visualisasi DNA, sekuens dan BLAST. Optimasi suhu annealing dilakukan pada amplifikasi DNA. Berdasarkan identifikasi molekuler dengan menggunakan primer universal ITS1 5' TCCGTAGGTGAACCTGCGG 3' dan ITS4 5' TCCTCCGCTTATTGATATGC 3' dan persamaan homologi, isolat MKMS 2.1 merupakan Trichoderma reesei (100%) dan PKMS 2.2 merupakan spesies Fusarium solani (99,81%). A sponge is an organism that has pores and belongs to the Porifera phylum. These animals are filter feeders where the sponge filters its food into the body cavity, so the sponge can eat organic algae particles, and microbes, including fungi. Mold is a eukaryotic microorganism from Fungi kingdom, multicellular, that forms mycelium without fruiting body formation. Mold has an important role in balancing the environmental quality in an ecosystem. The purpose of this study was to identify two molds that had been isolated from sponge in the mangrove ecosystem using DNA barcoding. The study was conducted in April-October 2019 in Laboratory of Tropical Marine Biotechnology using the experimental laboratory method. The methods in this research were isolation refreshment, morphological characterization which were consisted of colony color, texture, reverse, exudates, sclerotia, conidia, conidiophores, spores, and septa. Molecular identification consisted of DNA extraction, amplification, electrophoresis, DNA visualization, sequences and BLAST. Annealing temperature optimization is carried out on DNA amplification. Based on molecular identification using universal primers ITS1 5 'TCCGTAGGTGAACCTGCGG 3' and ITS4 5 'TCCTCCGCTTATTGATATGC 3' and homological equations, MKMS 2.1 isolates were identified as Trichoderma reesei (100%) and PKMS 2.2 were identified as Fusarium solani (99.81%).
Kandungan Senyawa Bioaktif dan Aktivitas Biologis Daun Mangrove Lumnitzera racemosa di Pantai Teluk Awur dan Pantai Blebak Jepara Dewi, Melati Sukma; Tri Nuraini, Ria Azizah; Yulianto, Bambang; Sibero, Mada Triandala
Journal of Marine Research Vol 12, No 3 (2023): Journal of Marine Research
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14710/jmr.v12i3.34584

Abstract

Lumnitzera racemosa tumbuh luas di hutan bakau di daerah tropis, menjanjikan potensi sumber daya untuk digunakan manusia sebagai bahan farmakalogi dari senyawa bioaktif yang terkandung di dalamnya. Penelitian sebelumnya menunjukkan ekstrak L. racemosa berpotensi sebagai antimikroba, antihipertensi, anti diare, dan antioksidan. Tujuan penelitian ini adalah untuk mengetahui karakteristik senyawa bioaktif dan juga mengetahui aktivitas antibakteri dan antioksidan pada ekstrak daun mangrove L. racemosa asal Pantai Teluk Awur dan Pantai Blebak, Jepara, Jawa Tengah. Metode ekstraksi menggunakan maserasi bertingkat dengan tiga pelarut berbeda berdasarkan kepolarannya. Uji fitokimia dan Analisa Metabolite Finger Printing dengan TLC (Thin Layer Chromatography) dilakukan untuk mengetahui senyawa bioaktif yang terkandung dalam daun mangrove L. racemosa, untuk mengetahui aktivitas biologis yaitu aktivitas antibakteri digunakan metode agar well dengan menggunakan empat bakteri MDR (Multi Drug Resistance), sedangkan uji aktivitas antioksidan menggunakan metode DPPH (2,2-difenil-1-pikrilhidrazil). Hasil uji fitokimia menujukkan senyawa bioaktif ekstrak daun L. racemosa yang meliputi alkaloid, flavonoid, fenol hidrokuinon, dan steroid. Analisa Metabolite Finger Printing dengan uji TLC menunjukkan senyawa bioaktif yang terkandung antara lain: terpenoid, fenol, dan alkaloid dan positif menunjukkan aktivitas antioskidan. Aktivitas antibakteri, menunjukkan hasil negatif yaitu tidak terbentuknya zona hambat pada ke empat bakteri. Aktivitas antioksidan dilihat dari nilai IC50 daun L. racemosa Pantai Teluk Awur menujukkan nilai IC50 paling baik adalah ekstrak metanol 161,606 ppm (lemah) sedangkan pada lokasi Pantai Blebak menunjukkan nilai IC50 yang berpotensial pada ekstrak etil asetat 17,441 ppm (sangat kuat). Daun mangrove L. racemosa Pantai Teluk Awur dan Pantai Blebak memiliki potensi untuk bidang farmakologi dilihat dari hasil aktivitas senyawa bioaktif yang terkandung dalam daun L. racemosa. Lumnitzera racemosa grows widely in mangrove forests in the tropics, promising potential resources for pharmaceutical ingredients from the bioactive compounds contained in it. Previous studies have shown the extract may have biological activities such as antimicrobial, antihypertensive, antidiarrheal, and antioxidant. The purpose of this study was to determine the bioactive antibacterial compounds and also to determine the activity and antioxidants in the extract of the mangrove leaves of L. racemosa from Teluk Awur Beach and Blebak Beach, Jepara, Central Java. The extraction method uses graded maceration with three different solvents based on their polarity. Phytochemical tests and Metabolite Finger Printing Analysis with Thin Layer Chromatography (TLC) tests were carried out to determine the bioactive compounds contained in the mangrove leaves of L. racemosa, to determine the biological activity, namely the antibacterial activity used by the agar method using four MDR (Multi-Drug Resistance) bacteria, while the activity test antioxidant using the DPPH method (2,2-diphenyl-1-picrylhydrazyl). The results of the phytochemical test showed that the bioactive compounds of L. racemosa leaf extract included: alkaloids, flavonoids, phenol hydroquinone, and steroids. Metabolite Finger Printing Analysis with Thin Layer Chromatography (TLC) test showed that the bioactive compounds contained include terpenoids, phenols, and alkaloids and positively indicated antioxidant activity. Antibacterial activity showed negative results, namely no inhibition zone was formed on bacterial empathy. Antioxidant activity seen from the IC50 value of L. racemosa leaves showed the best IC50 value was methanol extract 161,606 ppm (weak) while at Blebak Beach location showed possible IC50 value in ethyl acetate extract 17,441 ppm (very strong). The mangrove leaves of L. racemosa Teluk Awur Beach and Blebak Beach have potential in the field of pharmacology seen from the results of the activity of bioactive compounds contained in the leaves of L. racemosa leaves.