Article Per Year (5 Year)
p-Index From 2021 - 2026
0.888
P-Index
This Author published in this journals
All Journal Jurnal Teknologi Dan Industri Pangan Jurnal Pengolahan Hasil Perikanan Indonesia Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Jurnal Abdi Masyarakat Indonesia
Melati, Rahadina Praba
Program Studi Teknologi Hasil Pertanian, Sekokah Vokasi, Universitas Sebelas Maret, Indonesia
Agriculture, Biological Sciences & Forestry Humanities Biochemistry, Genetics & Molecular Biology Economics, Econometrics & Finance Education Engineering Industrial & Manufacturing Engineering Public Health Veterinary

Published : 4 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 4 Documents
Search

 1 
SIMPLEKS DAN MULTIPLEKS PRE-ENRICHMENT-PCR UNTUK DETEKSI Salmonella Enteritidis DAN Typhimurium PADA KARKAS AYAM Siti Nurjanah; Winiati P. Rahayu; Ratih Dewanti-Hariyadi; Ni Gusti Ayu Made Widyatari Asthiti; Rahadina Praba Melati
Jurnal Teknologi dan Industri Pangan Vol. 32 No. 2 (2021): Jurnal Teknologi dan Industri Pangan
Publisher : Departemen Ilmu dan Teknologi Pangan, IPB Indonesia bekerjasama dengan PATPI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.6066/jtip.2021.32.2.148

Abstract

A PCR assay has been developed and applied to detect Salmonella contamination in chicken carcasses. However, a concentration fewer than 3 cells per gram lead to false-negative results due to difficulties in the DNA extraction. The objective of this study was to evaluate of the influence of pre-enrichment on the sensitivity of simplex and multiplex PCR methods the detection of for Salmonella spp., S. Enteritidis and S. Typhimurium in chicken carcasses. Artificial contamination was done using very low number of Salmonella Hadar, S. Enteritidis dan S. Typhimurium and pre-enrichment was carried out by 8 hours incubation in non-selective (BPW) medium. The results showed that simplex PCR could detect Salmonella spp., S. Enteritidis and S. Typhimurium at initial numbers of 2.3, 0.9 and 2.3 MPN/mL of cells in broth medium, respectively. A multiplex PCR could detect mixed culture of the three Salmonella serovars at an initial number of 0.73 MPN/mL of cells. When compared to non-enrichment treatment, simplex pre-enrichment-PCR gave an increase in the percentage of positive results in chicken carcasses (n= 12), from 75 to 100% for Salmonella spp., from 8 to 58% for S. Typhimurium, and from 58 to 75% for S. Enteritidis. Increasing in the positive percentage was also occurred at multiplex pre-enrichment-PCR, however the concentration of S. Enteritidis primer was not optimum for detection. Pre-enrichment step significantly increases the sensitivity of PCR-based assay for detection Salmonella.
Desain Primer Gen Virulensi invA untuk Identifikasi dan Sekuensing Salmonella pada Sampel Karkas Ayam R. P. Melati; S. Nurjanah; W. P. Rahayu
Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 10 No. 2 (2022): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan
Publisher : Department of Animal Production and Technology, Faculty of Animal Science, IPB University in associated with Animal Scientist's Society of Indonesia (HILPI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jipthp.10.2.91-97

Abstract

Identification and sequencing of Salmonella require a specific primer as well as a virulence marker. Invasion gene (invA) is a gene found in all types of Salmonella, specific to Salmonella, and has a low mutation rate so that it can be used as a target gene for Salmonella identification. This study aimed to design a primer of invA gene of Salmonella spp. with long amplicons, has broad serovar coverage, and get an optimum PCR condition. Primers were designed and checked its specificity in silico using Primer-BLAST and then selected. Selected primer was evaluated for annealing temperature and primer concentration. Based on the sequential selection, it was obtained a set of invA gene primer with forwarding sequences GCCGGTGAAATTATCGCCAC (started at base 297) and reverses sequences CTCGTAATTCGCCGCCATTG (started at base 1763). Based on Primer-BLAST analysis, the primer gave an amplicon size of 1486 bp, has annealing temperature of 58 °C, capable of detecting at least 110 Salmonella serovars, capable to detect Salmonella contamination in chickens, and unable to detect the presence of Klebsiella sp., Citrobacter sp., Serratia sp., Hafnia sp., and E. coli. This primer can detect Salmonella very well with annealing temperature of 58 oC and primer concentration of 1.2 µM.
Formulasi dan evaluasi bumbu instan nasi goreng yang diperkaya dengan bubuk lemi rajungan: Formulasi dan evaluasi bumbu instan nasi goreng yang diperkaya dengan bubuk lemi rajungan Kusumaningrum, Indrati; Khotimah, Khusnul; Melati, Rahadina Praba; Afiah, Rahmania Nur; Affandi, Dian Rachmawanti
Jurnal Pengolahan Hasil Perikanan Indonesia Vol. 28 No. 12 (2025): Jurnal Pengolahan Hasil Perikanan Indonesia 28(12)
Publisher : Department of Aquatic Product Technology IPB University in collaboration with Masyarakat Pengolahan Hasil Perikanan Indonesia (MPHPI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17844/36x19x73

Abstract

Fried rice is one of Indonesia’s most popular dishes, creating a demand for practical seasoning alternatives such as instant seasoning made from crab lemi powder (LP), which provides a distinctive seafood flavor. This study aimed to evaluate the chemical, physical, and sensory characteristics of instant fried rice seasoning with varying proportions of LP and MSG. Four formulations (P0–P3) were developed using a completely randomized design. Chemical analyses included moisture, ash, protein, fat, carbohydrate, NaCl, and glutamate content. The physical analyses comprised measurements of bulk density, flowability, angle of repose, and color (L*, a*, and b*). Sensory evaluation was conducted using a hedonic test to assess color, aroma, taste, texture, and overall acceptability. Formulas P1 (34% LP : 3% MSG) and P2 (31% LP : 6% MSG) met the SNI standards for protein and fat content, with sodium levels significantly below the maximum limit, despite water content exceeds the standard (≤4%). Physically, all formulations showed densities of 0.71 to 0.74 g·mL⁻¹, flow times of 7.88 and 8.95 g·s⁻¹, and angles of repose below 30° (27.88°-28.61°), indicating excellent flowability and consistent color. Hedonic testing revealed that MSG addition had no significant impact on color, aroma, and texture but significantly improved taste and overall acceptability (p<0.05). Consequently, formulation P1, which had a lower MSG level, was identified as optimal, providing the best balance of physical stability, chemical quality, and sensory acceptability. This suggests its potential for development as a practical and safe instant fried rice seasoning product that is aligned with consumer preferences.
Penerapan Teknologi Tepat Guna untuk Meningkatkan Kualitas dan Produktivitas Bumbu Lemi Rajungan UMKM Pandega Food, Sukoharjo Afiah, Rahmania Nur; Kusumaningrum, Indrati; Melati, Rahadina Praba; Affandi, Dian Rachmawanti; Khotimah, Khusnul
Jurnal Abdi Masyarakat Indonesia Vol 6 No 1 (2026): JAMSI - Januari 2026
Publisher : CV Firmos

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.54082/jamsi.2325

Abstract

UMKM Pandega Food merupakan mitra usaha pengolahan bumbu penyedap berbasis limbah rajungan (lemi) yang menghadapi permasalahan ketidakstabilan mutu bubuk serta belum optimalnya manajemen stok bahan baku.  Kegiatan pengabdian ini bertujuan meningkatkan kualitas produk, efisiensi produksi, dan efektivitas pengelolaan bahan baku melalui penerapan teknologi tepat guna dan pendampingan teknis sehingga mampu bersaing secara lokal maupun nasional. Pelaksanaan kegiatan meliputi observasi lapangan, pelatihan penerapan Good Manufacturing Practices (GMP), pengadaan alat powder grinder dan powder mixer, serta pelatihan manajemen stok bahan baku. Hasil kegiatan menunjukkan peningkatan homogenitas bubuk, penurunan waktu proses, dan perbaikan daya simpan produk. Selain itu, mitra mampu menerapkan sistem pencatatan stok dan perencanaan bahan baku secara lebih terstruktur. Kegiatan ini memberikan dampak positif terhadap peningkatan kapasitas usaha dan kemandirian mitra, serta membuka peluang pengembangan produk turunan berbasis hasil samping rajungan secara berkelanjutan.
Co-Authors Afiah, Rahmania Nur Dian Rachmawanti Affandi, Dian Rachmawanti Indrati Kusumaningrum, Indrati khusnul khotimah Ni Gusti Ayu Made Widyatari Asthiti Ratih Dewanti -Hariyadi S. Nurjanah Siti Nurjanah W. P. Rahayu Winiati P. Rahayu