Claim Missing Document
Check
Articles

Found 5 Documents
Search

Pengaruh Jenis Alat Pengering Terhadap Karakteristik Fisik, Kimia dan Organoleptik Sup Labu Kuning Instan Rif’an Rif’an; Nurrahman Nurrahman; Siti Aminah
Jurnal Pangan dan Gizi Vol 7, No 2 (2017): Kajian Pangan dan Gizi
Publisher : Universitas Muhammadiyah Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.26714/jpg.7.2.2017.104-116

Abstract

ABSTRACTPumpkin has many contained a beta-karoten and antioxidant useful to maintain a body health. The diversification of pumpkin to be an instant soup was purposed to increase a economic value and determine for a dryer machine which was optimal and efficient to be a dryer for instant pumpkin soup. The method of this research was experiments methods using completely randomized design (RAL) monofactorial. The factor of this research was kind of dryer machine with drying treatment (cabinet dryer, vacuum dryer, oven dryer and drum dryer). The tests performed were the physical properties (Kamba density, yield and moisture content), chemical properties (Levels of beta-carotene and antioxidant activity), organoleptik characteristic (Taste, aroma, color and texture). Physical and chemical properties data were analyzed by ANOVA, and a further test using Duncan while the organoleptic test results was analyzed using the Friedman test and Wilcoxon test. The results indicated the type of dryer drying significantly different with the physical and organoleptic characteristics of pumpkin soup instant. whereas chemical characteristics were not significantly different. Best instant drying pumpkin soup was obtained from the type of the dryer drum dryer with the best treatment was (Kamba density (0.58 g / ml), yield (32.05%), savory (3.68), fragrance (3.82), viscous consistency (3.68). Keywords: pumpkin, drying, physical, chemical and organoleptic
Streptolysin Encoding Genes sagC and sagD as Biomarkers of Fish Pathogen Streptococcus iniae: An In Silico Study Stalis Norma Ethica; Sri Darmawati; Sri Sinto Dewi; Nurrahman Nurrahman; Ayu Rahmawati Sulistyaningtyas
Squalen, Buletin Pascapanen dan Bioteknologi Kelautan dan Perikanan Vol 15, No 1 (2020): May 2020
Publisher : Research and Development Center for Marine and Fisheries Product Processing and Biotechnol

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (576.394 KB) | DOI: 10.15578/squalen.v15i1.416

Abstract

Streptococcus iniae has been notorious as a serious tilapia fish pathogen leading to many disease outbreaks in warm water marine aquaculture. An in silico investigation about the potential of virulence genes of S. iniae, sagC and sagD, as biomarkers of the bacterial species, has been carried out. The aim was to determine bacterial biomarkers, which are important to facilitate early rapid diagnosis of S. iniae streptococcal infection in fish and also in humans. First, specific primers were designed from sagC and sagD genes of S. iniae SF1 genomic DNA using Primer3Plus. Next, in silico PCR (Polymerase Chain Reaction) analysis was carried out using the newly designed primers and 117 genomic DNA of streptococci (all species) retrieved from the database. Primers designed from sagC and sagD genes (SagCF: ‘5- TGCTGACCTCCTAAAAGGGC -3’ and SagCR: ‘5- CTATGCGGCGGGTTTAAGGT -3’ as well as SagDF: 5’- GCCAATCCAATCCTGTCATGC -3’ and SagDR: 5’- TGCAGCTTCCATAACCCCTC -3’) could result in a single band of each matching to 558-bp and 590-bp PCR products only from S. iniae. From 116 other streptococcal genomes studied using similar primers have resulted in no amplicon bands. A further check showed that the amplicons were truly part of sagC and sagD genes of S. iniae. These results showed that sagC and sagD genes appeared to be biomarkers of S. iniae, which are potential to be used to facilitate rapid diagnostic of the pathogenic bacterium.
Hubungan Kualitas, Harga Dan Kemasan Produk Terhadap Keputusan Pembelian Keripik Tulang Muda Sapi Sinar Rizkia Melinda; Muhammad Yusuf; Nurrahman Nurrahman
Prosiding Seminar Nasional Unimus Vol 5 (2022): Inovasi Riset dan Pengabdian Masyarakat Guna Menunjang Pencapaian Sustainable Developm
Publisher : Universitas Muhammadiyah Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Bisnis makanan menjadi pusat perhatian para pencinta kuliner yang kini menunjukan perkembangan yang sangat pesat. Pebisnis pada bidang kuliner dapat menghasilkan keuntungan dari usaha makanan yang dijalani. Salah satu bisnis makanan yang sedang berkembang saat ini adalah keripik. Keripik merupakan makanan ringan berupa irisan tipis yang terbuat dari umbi-umbian, buah-buahan atau sayuran yang digoreng di dalam minyak nabati. Salah satu produsen keripik yang cukup berhasil adalahUMKM Keripik Tulang Muda Sapi Sinar. Tujuan dari penelitian ini adalah mengetahui pengaruh promosi, harga dan kualitas produk dengan cara parsial dan simultan terhadap minat pembeli serta mengetahui variabel yang dominan mempengaruhi minat pembeli di UMKM Keripik Tulang Muda Sapi Sinar. Pengumpulan data melalui kuesioner, dilakukan uji keakuratan kuesioner yaitu uji validitas dan uji reliabilitas. Pengujian hipotesis dilakukan melalui uji F, uji t dan uji dominan. Sampel pada penelitian iniberjumlah 75 responden. Jenis penelitian ini ialah jenis penelitian deskriptif. Pada penelitian ini diketahui secara parsial, kualitas (X1) dan harga (X2) tidak berpengaruh terhadap keputusan pembelian (Y) dan kemasan (X3) berpengaruh terhadap keputusan pembelian (Y).Kata Kunci: Keripik Tulang Muda, Kualitas, Harga, Keputusan Pembelian, Promosi.
Pemanfaatan Sari Kunyit Asam Untuk Meningkatkan Karakteristik Fisik, Vitamin C Dan Sensori Permen Jelly Labu Siam Indy Rizki Agustin; Nurrahman Nurrahman; Siti Aminah
Prosiding Seminar Nasional Unimus Vol 5 (2022): Inovasi Riset dan Pengabdian Masyarakat Guna Menunjang Pencapaian Sustainable Developm
Publisher : Universitas Muhammadiyah Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Labu siam merupakan bahan lokal yang memiliki komoditas melimpah. Beberapa penelitian sudah meneliti tentang pembuatan permen labu siam tetapi masih ada kelemahan, sehingga perlu ditambahkan bahan lain untuk memperbaiki cita rasa permen jelly. Sari kunyit asam merupakanbahan lokal yang berpotensi memiliki warna dan kandungan gizi. Penambahan sari kunyit asam pada permen jelly labu siam selain meningkatkan komponen gizi juga dapat memberikan warna dan rasayang enak karena mengandung kurkuminoid dan tumerin. Tujuan penelitian ini untuk mengetahui pengaruh penambahan sari kunyit asam terhadap total padatan terlarut, kekenyalan (springiness), vitamin C dan sensori pada permen jelly labu siam. Pembuatan permen jelly labu siam diawali dengan membuat bubur labu siam ,sari kunyit asam dan pembuatan permen jelly labu siam dengan penambahan sari kunyit asam (0, 10, 20, 30, dan 40%). Analisis yang dilakukan meliputi: totalpadatan terlarut, kekenyalan (springiness), vitamin C dan karakteristik sensori. Desain penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 5 perlakuan. Hasil penelitian menunjukkan bahwa penambahan sari kunyit asam berpengaruh nyata terhadap total padatan terlarut, kekenyalan (springiness), vitamin C, aroma, tekstur, rasa dan warna. Perlakuan terbaik diperoleh pada perlakuan penambahan sari kunyit asam 20%.Kata kunci : Labu siam, kunyit asam, permen jelly, vitamin C, kekenyalan
Transformation of Da’wah Communication from the Perspective of Islamic Communication: A Literature Study Nurrahman Nurrahman; Zeira Salim Ritonga; Gusti Prabowo; Muhammad Syaifur Rozaq; Ahmad Tamrin Sikumbang
Bulletin of Indonesian Islamic Studies Vol. 4 No. 2 (2025): Bulletin of Indonesian Islamic Studies
Publisher : KURAS Institute

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51214/biis.v4i2.1779

Abstract

This article analyzes the transformation of Da’wah communication in the digital era from the perspective of Islamic communication. The study is motivated by the rapid shift of Da’wah activities toward digital platforms, which expands the dissemination of Islamic messages but also raises challenges related to religious authority, message commodification, and ethical communication. Despite the increasing presence of digital Da’wah, studies that integrate these developments with the normative principles of Islamic communication remain limited. Therefore, this research aims to examine the patterns of transformation in digital Da’wah and identify the relevance of Islamic communication values in guiding its development. This study employs a qualitative literature review approach. Data were collected from scholarly books and peer-reviewed journal articles published within the last five years that discuss digital Da’wah, Da’wah communication strategies, and Islamic communication principles. The selected literature was analyzed using thematic analysis to identify major patterns, conceptual arguments, and emerging issues. Data verification was conducted through cross-comparison among sources to ensure consistency and reliability. The findings indicate that digital Da’wah transforms communication practices through message visualization, short narratives, and interactive storytelling that encourage two-way engagement between da'i and mad'u. While digital media broadens the reach and inclusivity of Da’wah, it also introduces risks of shifting authority and commercialization of religious content. This study contributes by proposing the reinforcement of Islamic communication values qawlan sadīdan, qawlan balīghan, qawlan ma‘rūfan, and qawlan layyinan as an ethical framework for adaptive and socially transformative digital Da’wah