Claim Missing Document
Check
Articles

Found 9 Documents
Search

ANALISA BIOINFORMATIKA GEN E1 DAN E2 DARI VIRUS HEPATITIS C (HCV) GENOTIPE 1, 2, 3 DAN 6 SEBAGAI KANDIDAT VAKSIN VIRAL-LIKE PARTICLES (VLP) Saraswati, Henny
Indonesian Journal of Biotechnology and Biodiversity Vol 1, No 2 (2017): Indonesian Journal of Biotechnology and Biodiversity
Publisher : Indonesian Journal of Biotechnology and Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

AbstractHepatitis C virus (HCV) causes hepatitis disease. This disease is dangerous due to the large number of people with chronic hepatitis infection. Chronic hepatitis infection may progress to cirrhosis, liver cancer and death. The mortality rate due to liver cancer is quite large and occupies the top 10 causes of death in the world. HCV vaccine is necessary to prevent HCV transmission. The challengeof this vaccine developmentis the genotypes circulate in the world. In Indonesia, there are genotypes 1, 2, 3 and 6. HCV vaccine should be able to protect from most genotype. Therefore, the development of HCV vaccine takes a long time. One vaccine approach sounds promisingis VLP (Viral-like Particles) vaccine. The E1 E2 protein on the surface of the virus is an excellent candidate for VLP vaccine material, because of its immunogenecity. In this study, we didbioinformatics studyto analyzes E1 and E2 genes from genotypes 1, 2, 3 and 6. These genes sequences are obtained fromGenBank, and analyzed further using softwares such as BioEdit Sequence Alignment Editor, BLAST and BLAST Primer. From this study we can obtain E1-E2 gene consensus sequence and also conserved region of E1 and E2 gene sequence. The results of this study can be further used in the development of HCV VLP vaccine candidates. Keywords : VLP vaccine, E1 gene, E2 gene. AbstrakVirus Hepatitis C (HCV) merupakan penyebab penyakit hepatitis. Penyakit ini berbahaya dikarenakan besarnya angka penderita infeksi hepatitis kronis. Infeksi hepatitis kronis dapat berlanjut menjadi sirosis dan kanker hati, hingga kematian. Angka kematian karena kanker hati cukup besar dan menempati 10 besar penyebab kematian tertinggi di dunia. Vaksin HCV sangat diperlukan untuk mencegah penularan infeksi. Kesulitan yang dihadapi adalah banyaknya genotipe HCV yang beredar. Di Indonesia sendiri terdapat genotipe 1, 2, 3 dan 6. Vaksin HCV harus dapat memberikan proteksi terhadap infeksi beberapa macam genotipe. Oleh karena itu, pengembangan vaksin HCV memerlukan waktu yang cukup lama. Salah satu pendekatan vaksin adalah dengan vaksin VLP (Viral-like Particles). Protein E1E2 yang terdapat pada permukaan virus merupakan kandidat yang sangat baik untuk dijadikan bahan vaksin VLP karena memiliki imunogenesitas yang tinggi. Dalam penelitian ini dilakukan analisa bio informatika terhadap gen E1 dan E2 dari genotipe 1, 2, 3 dan 6. Sekuen gen-gen ini diperoleh melalui Gen Bank dan dianalisa lebih lanjut menggunakan beberapa perangkat lunak seperti Bio Edit Sequence Alignment Editor, BLAST dan Primer BLAST. Berhasil didapatkan sekuen konsensus gen E1-E2 dan juga sekuen lestari dari gen E1 dan E2. Diharapkan hasil penelitian ini dapat digunakan lebih lanjut dalam pengembangan kandidat vaksin VLP HCV. Kata kunci : Vaksin VLP, gen E1, gen E2.
In-Silico Analysis for cryI Gene Amplification from Bacillus thuringiensis Febriana Dwi Wahyuni; Henny Saraswati; Kartika Sari Dewi
BIOEDUKASI Vol 18 No 1 (2020)
Publisher : PROGRAM STUDI PENDIDIKAN BIOLOGI FAKULTAS KEGURUAN DAN ILMU PENDIDIKAN UNIVERSITAS JEMBER

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.19184/bioedu.v18i1.16430

Abstract

Abstract Bacillus thuringiensis is one type of bacteria that has been used as a microbiological control agent for pests and a vector of plant disease. The presence of Cry proteins inside the B. thuringiensis can be acted as a specific insect repellent that only toxic to certain insects. The CryI protein is toxic to Lepidoptera insects which can attack various types of plants. Polymerase Chain Reaction (PCR) is a common method that can be used to amplify the gene encoding CryI proteins from B. thuringiensis. This research aimed to design a good primer candidate for cryI gene amplification from B. thuringiensis. In silico analysis for designing cryI primer was carried out using some software, such as BLAST for searching cryI gene sequence, Bioedit for sequences alignment, and DINAmelt for analyzing dimer structure of primers. Ten primer candidates were successfully obtained based on the result of the primer3 software. A pair of primer was selected to amplify the cryI gene, with forward primer 5’- CGGTGAATGCCCTGTTTACT -3’ and reverse primer 5’-CGGTCTGGTTGCCTATTGAT -3’. Amplification of the cryI gene by PCR method using selected primer resulting in a PCR product with a length of approximately 200 bp.
Optimization of Real-Time PCR Conditions for COVID-19 Diagnosis with Logix Smart Reagent™ Anisa Febriyanti; Seprianto Seprianto; Titta Novianti; Febriana Dwi Wahyuni; Oktaviani Naulita Turnip; Roselein Putri; Henny Saraswati
BIOEDUKASI Vol 20 No 1 (2022)
Publisher : PROGRAM STUDI PENDIDIKAN BIOLOGI FAKULTAS KEGURUAN DAN ILMU PENDIDIKAN UNIVERSITAS JEMBER

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.19184/bioedu.v20i1.28356

Abstract

Corona Virus Disease 2019 or COVID-19 is a new type of virus that attacks the respiratory tract and can cause death. Laboratory examinations play an essential role in diagnosing COVID-19 with a set of reagents or kits. Sampiand sampling is carried out with a nasopharyngeal swab or oropharyngeal swab. Positive samples of COVID-19 patients used in this study were converted into RNA at the COVID-19 Referral Clinic in Bekasi, after which volume optimization was carried out with a total volume of 5 µl, 8 µl, and 10 µl with the Logix Smart™ kit. The method in this study uses One-Step Real-time PCR. This method is the best method for carrying out several bear tests because it can reduce the possibility of sample contamination. The procedure is fast and has high sensitivity. The fluorescence detection used in this study was FAM with a specific target of COVID-19 RNA and ROX with a particular DNA target of RNase-P. This research was conducted to obtain optimal volume conditions under the manufacturer's standards in detecting the SARS-CoV-2 virus. The results of this study indicate that a total volume of 5 l is the optimal total volume for detecting the presence of the SARS- CoV-2 virus in samples taken from patients.
PEMANFAATAN SAMPAH ORGANIK RUMAH TANGGA MENJADI ECO-ENZYME CAIRAN SEJUTA MANFAAT DI CLUSTER MALTA SENTRALAND PARADISE KEC. PARUNG PANJANG Seprianto Seprianto; Henny Saraswati; Febriana Dwi Wahyuni; Titta Novianti; Adri Nora; Putri Handayani
J-ABDI: Jurnal Pengabdian kepada Masyarakat Vol. 2 No. 8: Januari 2023
Publisher : Bajang Institute

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.53625/jabdi.v2i8.4528

Abstract

Keberadaan sampah dari limbah rumah tangga yang berlebihan di lingkungan merupakan salah satu masalah penting karena dapat merusak keseimbangan ekosistem lingkungan. Perlu adanya pengelolaan terhadap limbah rumah tangga tersebut supaya tidak menimbulkan dampak negatif bagi lingkungan dan kesehatan masyarakat. Perumahan Sentraland paradise merupakan perumahan baru yang terletak di Desa Kabasiran, Kecamatan Parung Panjang Kab. Bogor yang terdiri berbagai cluster salah satunya cluster Malta. Salah satu pemanafaatan sampah organik dari limbah rumah tangga adalan cairan serbaguna eco enzyme. Cairan serbaguna ini bisa menjadi karbol pembersih alami, sabun cuci piring, pemurni udara, pembersih luka, sanitizer alami, pupuk cair, dan cairan pestisidia untuk tanaman. Ada 10 warga yang ikut dalam kegiatan ini, sedikitnya warga yang ikut dikarenakan punya kegiatan lain sehingga tidak dapat berpartisipasi. Selama kegiatan berlangsung peserta sangat aktif bertanya dan berdiskusi dengan pemateri. Pelaksanaan praktek warga ikut terlibat dalam pembuatan eco-enzyme. Kegiatan ini sangat bermanfaat karena banyak informasi yang didapatkan warga tentang bagaimana pemanfaatan sampah dapur yang selama ini hanya dibuang menjadi produk yang bernilai. Kegiatan ini diharapkan dapat memberikan solusi dalam penanganan sampah organik rumah tangga menjadi produk eco-enzyme yang memiliki sejuta manfaat serta menjadi produk komersial yang dapat menjadi tambahan pendapatan warga Malta.
Optimasi Volume Kit Da An Gene Untuk Deteksi SARS-CoV-2 dengan Real Time RT-PCR Seprianto; Muhammad Arreza; Titta Novianti; Febriana Dwi Wahyuni; Oktaviani Naulita Turnip; Roaslein Putri; Henny Saraswati
BIOEDUSCIENCE Vol 6 No 2 (2022): BIOEDUSCIENCE
Publisher : Universitas Muhammadiyah Prof. Dr. Hamka

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (566.732 KB) | DOI: 10.22236/j.bes/628595

Abstract

Background: SARS-CoV-2 is a new type of coronavirus of the genus Betacoronavirus and the family Coronaviridae that causes a respiratory disease called COVID-19. The virus has a sheath and genetic material in the form of single-chain RNA. The genome structure of this virus is divided into two types, namely genes that encode non-structural proteins consisting of the ORF1a / ORF1b gene and genes that encode structural proteins consisting of spike glycoprotein (S), envelope (E), membrane glycoprotein (M), and nucleocapsid protein (N). Methods: The method of detecting SARS-CoV-2 with real time RT-PCR is the most recommended method because it has high specificity and accuracy. The specificity of a method is necessary to be able to specifically recognize the pathogen that causes the disease. Real time RT-PCR requires sampling with a swab on the oropharynx or nasopharynx to be examined in the laboratory which later the presence of viral RNA becomes a molecule that is assessed for diagnosis results. In this study, volume optimization was carried out on the Da An Gene kit used for the detection of SARS-CoV-2 with Reverse Transcription Polymerase Chain Reaction (Real time RT-PCR) with the aim of saving the use of reagents from available kits but with amplification results remaining optimal and accurate. Results: There were three SARS-CoV-2 RNA samples used consisting of N62, N63, and N79 samples and three types of total volume used were 20 μl, 15 μl, and 10 μl. The results of this study showed that the three positive samples contained SARS-CoV-2 with a Cq value of < 40. Conclusion: A volume of 20 μl is the optimal volume, which is more efficient than the manufacturer's recommended volume of 25 ul.
MUTATION DETECTION OF MULTIDRUG-RESISTANT TUBERCULOSIS BY RT-PCR METHOD AS THE DIAGNOSTIC TOOL OF MDR-TB Titta Novianti; alfero Putra Iryanto; feby feby; callista marsya; putri mega utami; febriana dwi wahyuni; henny saraswati; seprianto; adri nora; roaslein putri; nie nie; sabar pambudi
Jurnal Bioteknologi & Biosains Indonesia (JBBI) Vol. 10 No. 1 (2023): Juni 2023
Publisher : Balai Bioteknologi, Badan Pengkajian dan Penerapan Teknologi (BPPT)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29122/jbbi.v10i1.5653

Abstract

Eight percent of tuberculosis (TB) cases worldwide are resistant to rifampicin, with mutations occurring in the rpoB and katG genes. It is necessary to develop a specific multidrug-resistant (MDR) diagnostic technique using the RT-PCR method in Indonesia to aid in rapid and accurate diagnosis. In-silico testing using SnapGene software resulted in the design of DNA primers for the katG and rpoB genes, plasmids, and specific probes. This study employed a cross-sectional design using 30 non-MDR-TB and MDR-TB samples from RSUD Sitanala, Tangerang Banten, which were tested for amplification of the katG and rpoB genes using Sybr green RT-PCR. Validity testing was conducted using specific probes for the katG and rpoB genes. The amplification results showed that MDR-TB samples and MDR-TB plasmids required a longer time compared to non-MDR-TB samples and non-MDR-TB plasmids. The Quantification Cycle (Cq) value in non-MDR-TB samples was lower than the Cq value in MDR-TB samples. A t-test revealed a significant difference in Cq values of the rpoB and katG genes between MDR-TB and non-MDR-TB patients (p-value < 0.005). These differences in Cq values indicate that the findings of this study can serve as an initial reference for the development of an RT-PCR-based diagnostic kit for MDR-TB.
Optimasi Volume Kit Da An Gene Untuk Deteksi SARS-CoV-2 dengan Real Time RT-PCR Seprianto Seprianto; Muhammad Arreza; Titta Novianti; Febriana Dwi Wahyuni; Oktaviani Naulita Turnip; Roaslein Putri; Henny Saraswati
BIOEDUSCIENCE Vol 6 No 2 (2022): BIOEDUSCIENCE
Publisher : Universitas Muhammadiyah Prof. Dr. Hamka

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22236/j.bes/628595

Abstract

Background: SARS-CoV-2 is a new type of coronavirus of the genus Betacoronavirus and the family Coronaviridae that causes a respiratory disease called COVID-19. The virus has a sheath and genetic material in the form of single-chain RNA. The genome structure of this virus is divided into two types, namely genes that encode non-structural proteins consisting of the ORF1a / ORF1b gene and genes that encode structural proteins consisting of spike glycoprotein (S), envelope (E), membrane glycoprotein (M), and nucleocapsid protein (N). Methods: The method of detecting SARS-CoV-2 with real time RT-PCR is the most recommended method because it has high specificity and accuracy. The specificity of a method is necessary to be able to specifically recognize the pathogen that causes the disease. Real time RT-PCR requires sampling with a swab on the oropharynx or nasopharynx to be examined in the laboratory which later the presence of viral RNA becomes a molecule that is assessed for diagnosis results. In this study, volume optimization was carried out on the Da An Gene kit used for the detection of SARS-CoV-2 with Reverse Transcription Polymerase Chain Reaction (Real time RT-PCR) with the aim of saving the use of reagents from available kits but with amplification results remaining optimal and accurate. Results: There were three SARS-CoV-2 RNA samples used consisting of N62, N63, and N79 samples and three types of total volume used were 20 μl, 15 μl, and 10 μl. The results of this study showed that the three positive samples contained SARS-CoV-2 with a Cq value of < 40. Conclusion: A volume of 20 μl is the optimal volume, which is more efficient than the manufacturer's recommended volume of 25 ul.
Optimasi Volume Kit Da An Gene Untuk Deteksi SARS-CoV-2 dengan Real Time RT-PCR Seprianto Seprianto; Muhammad Arreza; Titta Novianti; Febriana Dwi Wahyuni; Oktaviani Naulita Turnip; Roaslein Putri; Henny Saraswati
BIOEDUSCIENCE Vol 6 No 2 (2022): BIOEDUSCIENCE
Publisher : Universitas Muhammadiyah Prof. Dr. Hamka

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22236/j.bes/628595

Abstract

Background: SARS-CoV-2 is a new type of coronavirus of the genus Betacoronavirus and the family Coronaviridae that causes a respiratory disease called COVID-19. The virus has a sheath and genetic material in the form of single-chain RNA. The genome structure of this virus is divided into two types, namely genes that encode non-structural proteins consisting of the ORF1a / ORF1b gene and genes that encode structural proteins consisting of spike glycoprotein (S), envelope (E), membrane glycoprotein (M), and nucleocapsid protein (N). Methods: The method of detecting SARS-CoV-2 with real time RT-PCR is the most recommended method because it has high specificity and accuracy. The specificity of a method is necessary to be able to specifically recognize the pathogen that causes the disease. Real time RT-PCR requires sampling with a swab on the oropharynx or nasopharynx to be examined in the laboratory which later the presence of viral RNA becomes a molecule that is assessed for diagnosis results. In this study, volume optimization was carried out on the Da An Gene kit used for the detection of SARS-CoV-2 with Reverse Transcription Polymerase Chain Reaction (Real time RT-PCR) with the aim of saving the use of reagents from available kits but with amplification results remaining optimal and accurate. Results: There were three SARS-CoV-2 RNA samples used consisting of N62, N63, and N79 samples and three types of total volume used were 20 μl, 15 μl, and 10 μl. The results of this study showed that the three positive samples contained SARS-CoV-2 with a Cq value of < 40. Conclusion: A volume of 20 μl is the optimal volume, which is more efficient than the manufacturer's recommended volume of 25 ul.
WORKSHOP ISOLASI DNA DAN PENGENALAN ALAT LABORATORIUM BIOTEKNOLOGI BAGI GURU BIOLOGI SMA/MA SE JAKARTA Seprianto Seprianto; Henny Saraswati; Febriana Dwi Wahyuni; Titta Novianti; Adri Nora; Aroem Naroeni; Putri Handayani
J-ABDI: Jurnal Pengabdian kepada Masyarakat Vol. 2 No. 3: Agustus 2022
Publisher : Bajang Institute

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.53625/jabdi.v2i3.2780

Abstract

Pengembangan bioteknologi dalam pengelolaan sumberdaya hayati dapat menjadi potensi terbesar dalam bidang biodiversitas dan menjadi aset nyata untuk kesejahteraan masyarakat. Bioteknologi didukung dengan metode – metode mutakhir serta fasilitas laboratorium yang memadai untuk mewujudkan keilmuan yang mampu dipahami oleh para siswa dengan transfer ilmu yang baik dari seorang guru biologi. Guru yang menguasai materi pelajaran dengan baik, menggunakan metode dan media pembelajaran yang tepat, mampu mengelola kelas dengan baik akan memberi pengaruh yang positif terhadap prestasi belajar siswa. Pengabdian ini bertujuan untuk menambah wawasan materi tentang DNA, mampu melakukan isolasi DNA dengan benar serta mengenal jenis alat – alat laboratorium yang digunakan untuk mengisolasi dan visualisasi DNA. Peserta dihadiri sebanyak 23 orang yang tersebar dari berbagai SMAN/SMAS se Jakarta. Pelaksanan pengabdian dilakukan dengan 2 metode yaitu klasikal dan praktek di laboratorium. Kegiatan berjalan dengan baik dan lancar. Evaluasi kegiatan dilihat dari hasil kuisioner yang diisi oleh peserta yang merasa sangat berkesan dan bermanfaat dalam menjelaskan materi bioteknologi. Harapan kedepan dari peserta adanya pelatihan yang lebih advance dalam bidang bioteknologi seperti kultur jaringan, teknologi DNA rekombinan, stem cell, kloning gen dan kultur mikroba di Laboratorium.