cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
Roni Koneri
Contact Email
ronicaniago@unsrat.ac.id
Phone
+6281340275276
Journal Mail Official
j.bioslogos@gmail.com
Editorial Address
Jurusan Biologi FMIPA Universitas Sam Ratulangi
Location
Kota manado,
Sulawesi utara
INDONESIA
Jurnal Bios Logos
Published by Universitas Sam Ratulangi
ISSN : 20889569     EISSN : 26563282     DOI : https://doi.org/10.35799/jbl.11.2.2020.28153
Core Subject : Health, Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Immunology & microbiology Medicine & Pharmacology
JURNAL BIOS LOGOS is the journal published by Department of Biology, Faculty of Mathematics and Natural Sciences, Sam Ratulangi University. The aims of the journal are to publish original research papers and article review in biology science i.e. botany, zoology, molecular biology, microbiology, ecology, diversity and conservation, taxonomy and biogeography. BIOS LOGOS is published two times per year (February and August)
Arjuna Subject : Ilmu Pertanian dan Biologi (Semua) - Ilmu Pertanian dan Biologi (Lain-Lain)
Articles 5 Documents
 1 
Search results for , issue "Vol 5, No 2 (2015): JURNAL BIOSLOGOS" : 5 Documents clear
Alokasi Biomassa pada Padi (Oryza sativa L.) Lokal Sulut Saat Kekurangan Air (Biomass Partitioning for North Sulawesi Local Rice (Oryza sativa L.) Cultivars under Water Deficit Condition) Nio, Song Ai; Lenak, Audry Agatha; Mantiri, Feky R; Mambu, Susan M; Ludong, Daniel PM
JURNAL BIOS LOGOS Vol 5, No 2 (2015): JURNAL BIOSLOGOS
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.5.2.2015.10550

Abstract

ABSTRAK Salah satu masalah utama yang menjadi kendala dalam produksi padi di Indonesia adalah kekurangan air yang melanda areal persawahan sehingga menjadi suatu ancaman untuk produksi padi. Masalah tersebut dapat diatasi dengan beberapa cara dan salah satunya dapat dilakukan melalui strategi adaptasi. Oleh sebab itu kajian sifat tahan kering pada padi lokal Sulawesi Utara (Sulut) perlu dilakukan, dalam upaya mendukung tercapainya tujuan strategis tersebut. Penelitian ini dilakukan untuk mengevaluasi sifat tahan kering pada empat varietas padi lokal Sulut (Burungan, Superwin, Temo dan Ombong) pada fase vegetatif saat kekurangan air berdasarkan alokasi biomassa. Setelah 14 hari perlakuan, rasio akar:tajuk pada keempat varietas menunjukkan bahwa varietas Superwin, Temo dan Burungan yang tidak diairi air memiliki rasio akar:tajuk yang lebih besar daripada yang diairi. Berdasarkan alokasi biomassa, sifat tahan kering Superwin, Temo dan Ombong lebih besar dibandingkan dengan Burungan, sehingga varietas ini potensial untuk ditanam di daerah kekurangan air. Kata kunci: biomassa, kekeringan, padi lokal Sulut, vegetative ABSTRACT One of the main problems in rice production in Indonesia is the lack of water and this condition resulted in the decrease of rice production. The problem can be solved in several ways and one of them is adaptation strategies. This study was conducted to evaluate drought resistance in four North Sulawesi local rice varieties (Burungan, Superwin, Temo and Ombong) at the vegetative phase under water deficit based on biomass allocation. After 14 days of treatment, the root:shoot ratio of Superwin, Temo and Burungan under drought were greater than under well-watered condition. Based on the biomass allocation, the drought resistance of Superwin, Temo and Ombong were greater than Burungan, so that these varieties were  potential to be grown in the water deficit areas. Keywords: biomass, drought, North Sulawesi local rice, vegetative
Kajian Pemanfaatan Kompos Jerami sebagai Substitusi Pupuk NPK pada Pertumbuhan dan Produksi Padi Sistem IPAT-BO (The Evaluation of Straw Compost Utilization as A Substitute of NPK Fertilizer on The Growth And Production of Rice By IPAT-BO System) Indrawaty, Kadengkang; Paulus, Jeanne M; Lengkong, Edy F
JURNAL BIOS LOGOS Vol 5, No 2 (2015): JURNAL BIOSLOGOS
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.5.2.2015.10551

Abstract

Abstrak Penelitian ini bertujuan untuk mengkaji dosis kompos jerami yang tepat untuk mensubstitusi pupuk NPK pada pertumbuhan dan produksi padi sistem IPAT-BO dengan menggunakan Rancangan Acak Kelompok (RAK) dengan 5 perlakuan dan 4 ulangan. Perlakuan terdiri dari I1=0% kompos jerami dan 100% pupuk NPK,  I2=25% kompos jerami dan 75% pupuk NPK,  I3 =50% kompos jerami dan 50% pupuk NPK; I4=75% kompos jerami dan 25% pupuk NPK dan I5=100 % kompos jerami dan 0 % pupuk NPK. Hasil penelitian menunjukkan bahwa pemupukan kompos jerami dan pupuk NPK berpengaruh nyata meningkatkan pertumbuhan padi sawah yang meliputi rata-rata tinggi tanaman dan jumlah anakan, namun tidak berpengaruh nyata pada produksi. Rata-rata tinggi tanaman tertinggi pada perlakuan I1 , I5, I3 dan I2 masing-masing 102,28 cm;  101,40 cm;  101,20 cm dan 100,28 cm. Jumlah anakan per rumpun terbanyak pada perlakuan I3 dan I1 masing-masing 33,48 anakan/rumpun dan 32,93 anakan/rumpun. Kata kunci : kompos jerami, IPAT-BO, padi,pupuk NPK   Abstract This study aimed to assess the proper dosage of straw compost as a substitute of NPK fertilizer on the growth and production of rice by IPAT BO system using a randomized block design (RAK) with 5 treatments and 4 replicates. The treatment consisted of I1 = 0% straw compost and 100% of NPK, I2 = 25% straw compost and 75% of NPK, I3 = 50% straw compost and 50% of NPK, I4 = 75% straw compost and 25% NPK fertilizer and I5 = 100% straw compost and 0% NPK fertilizer. The results showed that both of straw compost and NPK fertilizers significantly increased the growth of paddy rice crops, i.e. the plant height and number of tillers, but there was no significant effect on rice production. The highest plant height was observed in the treatments of I1, I5, I3 and I2, i.e. 102.28, 101.40, 101.20 and 100.28 cm, respectively.The highest number of tillers/clump was in the I3 and I1 treatments, i.e. 33.48 and 32.93 respectively. Keywords: IPAT-BO, NPK fertilizer, rice, straw compost
Pemanfaatan Cendawan Beauveria bassiana dalam Mengendalikan Hama Paraeucosmetus sp. Pada Tanaman Padi Sawah di Kabupaten Minahasa Selatan (The Use of Endophytic Fungi Beauveria bassiana to Control Paraeucosmetus sp. on Rice Plant in South Minahasa Dist Wowiling, Susan SCA; Pelealu, J; Maramis, R TD
JURNAL BIOS LOGOS Vol 5, No 2 (2015): JURNAL BIOSLOGOS
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.5.2.2015.10549

Abstract

Abstrak Telah dilakukan penelitian yang bertujuan untuk mengetahui efektivitas penggunaan beberapa dosis Beauveria bassiana terhadap mortalitas hama Paraeucosmetus sp.. Penelitian ini menggunakan Rancangan Acak Kelompok (RAK) dengan empat perlakuan yang diulang empat kali.  Perlakuan yang digunakan yaitu konsentrasi suspensi spora yang meliputi kontrol (tanpa suspensi spora cendawan), B. basiana dengan konsentrasi 106 spora/mL, B. basiana dengan konsentrasi 108 spora/mL, dan B. basiana dengan konsentrasi 1010 spora/mL. Serangga uji adalah Paraeucosmetus sp. yang diambil dari pertanaman padi di lokasi penelitian.  Jumlah serangga uji yang digunakan  sebanyak 20 ekor untuk masing-masing perlakuan. Hasil penelitian menunjukkan bahwa aplikasi B. bassiana terhadap hama Paraeucosmetus sp. memperlihatkan serangga uji agak lambat bergerak dan selanjutnya mengalami kematian. Pada permukaan tubuh serangga uji yang mati terlihat adanya spora yang berwarna putih menyerupai kapas terutama pada pertemuan antara kepala dan toraks, segmen antena, femur, tibia, dan pada segmen abdomen. Hari kelima tubuh serangga uji mulai mengalami mummified atau sebagian tubuhnya ditumbuhi oleh miselium yang berwana putih. Mortalitas serangga uji yang tertinggi setelah aplikasi suspensi spora cendawan B. bassiana ditemukan pada perlakuan 108 dengan tingkat mortalitas mencapai 100 %  pada hari kesembilan, diikuti dengan perlakuan 1010 mortalitas yang mencapai 100 % pada hari ke-12, dan pada perlakuan106 tingkat mortalitas mencapai 100 % pada hari ke-14. Pada kontrol belum ditemukan adanya serangga yang mati sampai pada pengamatan hari ke- 10. Pada perlakuan 108 mortalitas terjadi pada hari ke-2 setelah aplikasi yakni mencapai 1,25 % dan pada hari ke-9 mortalitas serangga uji mencapai 100 % serta tubuh serangga uji telah dipenuhi oleh miselium cendawan yang berwarna putih. Kata kunci: Beauveria bassiana, padi, Paraeucosmetus sp. Abstract A study was conducted to determine the effectiveness of the use of multiple doses of Beauveria bassiana against pest mortality Paraeucosmetus sp. The research method used a randomized block design (RAK) with four treatments which were repeated four times. The treatment was the concentration of spore suspensions, i.e. control (no fungus spore suspension), B. basiana with a concentration of 106 spores / mL, B. basiana with a concentration of 108 spores / mL, and B. basiana with a concentration of 1010 spores/mL. B. bassiana application for controlling Paraeucosmetus sp. in rice plant showed that the insects began to move slowly, died, then spores started to invest the body, especially in the junction between the head and thorax, antennae segments, femur and tibia, and abdominal segments. On the fifth day, the insect's body began to mummify (part of insect’s body was overgrown by mycelium which resembled white colored cotton). Observations on insect mortality after fungus application showed that the highest mortality was found in the treatment with 108 of spore suspension with the test insect mortality rate reached 100% on the ninth day. The insect mortality reached 100% on the 12th day in the treatment of 1010 spores/mL, and mortality reaches 100% on fourteenth day in the106 of spore suspension treatment. There was not any single dad insect found until the 10th day in control. One hundred percent mortality in each treatment showed that B. bassiana can effectively controlled Paraeucosmetus sp. Keywords: Beauveria bassiana, Paraeucosmetus sp., rice
DNA Barcoding Tanaman Daluga (Cyrtosperma spp) dari Kepulauan Sangihe Berdasarkan Gen matK (DNA Barcoding Daluga Plant (Cyrtosperma spp) of Sangihe Island Based on matK Gene) Julianti, Eka; Pinaria, Arthur; Lengkong, Edy F; Kolondam, Beivy J
JURNAL BIOS LOGOS Vol 5, No 2 (2015): JURNAL BIOSLOGOS
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.5.2.2015.10547

Abstract

Abstrak  Tanaman daluga (Cyrtosperma spp.) termasuk dalam famili Araceae (talas-talasan), umbinya berpotensi sebagai tanaman pangan alternatif karena mempunyai nilai gizi yang tinggi. Tanaman ini banyak terdapat di Kepulauan Sangihe. Penelitian ini dilakukan untuk mengetahui DNA barcoding daluga hijau, kuning dan belang-belang dengan menggunakan gen matK (maturase K). Ekstraksi DNA menggunakan Genomic DNA Mini Kit Plant (Geneaid), amplifikasi DNA menggunakan Kit PCR 5x FirePol Master Mix (Solis Biodyne) dan sepasang primer universal yaitu matK-3F-r (5’CGTACAGTACTTTTGTGTTTACGAG 3’) dan matK-1R-f (5’ACC CAGTCCATCTGGAAATCTTGGTTC3’). Hasil penelitian menunjukkan bahwa tanaman daluga hijau, daluga kuning, dan daluga belang-belang dari Kepulauan Sangihe memiliki sekuens DNA yang identik (kemiripan 100%). Daluga yang diteliti memiliki kemiripan sekuens dengan sampel di NCBI yaitu dengan Cyrtosperma macrotum (99,88%), Podolasia stipitata (99,50%), Dracontium polyphyllum (99,38 %), Pycnospatha arietina (99,38%) dan Dracontioides desciscen (99%). Dari hasil penelitian ini dapat disimpulkan bahwa DNA barcoding tanaman daluga dari kepulauan Sangihe berdasarkan gen matK belum dapat membedakan variasi intraspesies. Kata kunci: daluga, dalugha, Cyrtosperma spp. Abstract  Daluga (Cyrtosperma spp.) plant belongs to the family Araceae, the corm is potential as an alternative food because it has a high nutritional value. The plant is widely available in Sangihe Island. This study aimed to determine the DNA barcoding of green daluga, yellow daluga and mottled daluga using matK gene (maturase K). The DNA extraction used Genomic DNA Mini Kit Plant (Geneaid) and DNA amplification used the Kit PCR 5x FirePol Master Mix (Solis Biodyne) and universal primers matK-3F-R (5' CGTACAGTACTT TTGTGTTTACGAG 3') and matK-1R-f (5'ACCCAGAAATGGATCTCTTCCTGG TTC3'). The result showed that the green daluga, yellow daluga and mottled daluga from Sangihe Islands were identical (100% similarity). Daluga from Sangihe had similarities with the sample sequences in NCBI, namely Cyrtosperma macrotum (99.88%), Podolasia stipitata (99.50%), Dracontium polyphyllum (99,38%) Pycnospatha arietina (99.38%) and Dracontioides desciscen (99%). From these results it could be concluded that DNA barcoding of daluga plant from Sangihe based on the matK gene could not  distinguish variations intraspesies. Keywords: daluga, dalugha, Cyrtosperma spp.
Induksi Akar Rambut Gandarusa (Justicia gendarussa Burm. f.) dengan Perlakuan Perbedaan Lama Waktu Infeksi Agrobacterium rhizogenes strain YM072001 dan A4T (The Induction of Gandarusa (Justicia gendarussa Burm. f.) Hairy Root under Different Infection Wahyuni, Dwi Kusuma; Nisa, Qonitatun; Purnobasuki, Hery; Ermayanti, Tri Muji; Prajoga, Bambang; Utami, Edy SW
JURNAL BIOS LOGOS Vol 5, No 2 (2015): JURNAL BIOSLOGOS
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.5.2.2015.10548

Abstract

Abstrak Penelitian ini bertujuan untuk menginduksi akar rambut eksplan daun Gandarusa (Justicia gendarussa Burm.f.) dengan perlakuan perbedaan lama waktu infeksi Agrobacterium rhizogenes strain YM072001 dan A4T dan mengevaluasi lama waktu infeksi terbaik untuk induksi akar rambut. Eksplan daun diinokulasi di media MS (Murashige dan Skoog) cair yang berisi bakteri Agrobacterium rhizogenes dengan OD600 = 0,1 selama 10, 20, 30, 40, 50, dan 60 menit. Kokultivasi di MS padat selama 2 hari, lalu disubkultur ke media MS padat. Data dianalisis secara deskriptif. Akar rambut mulai tumbuh pada minggu ketiga. Induksi akar rambut berhasil pada eksplan dengan perlakuan strain YMB072001 dengan lama waktu infeksi 20, 40, dan 50 menit. Strain A4T juga berhasil menginduksi eksplan membentuk akar rambut dengan perlakuan 10 menit. Lama waktu infeksi terbaik untuk strain YMB072001 adalah 20 menit dan untuk strain A4T adalah 10 menit. Kata kunci: Agrobacterium rhizogenes, akar rambut, Justicia gendarussa Burm. f., waktu infeksi   Abstract The objective of this study were to induce hairy root of Gandarusa leaf explants by differences of Agrobacterium rhizogenes infection time treatment and to evaluate the best infection time for induction. Leaf explants were inoculated on MS (Murashige dan Skoog) liquid medium with bacterial concentrations of OD600 = 0,1 for 10, 20, 30, 40, 50, and 60 minutes and 2 days co-cultivated on MS0 solid medium then sub cultured on MS0 solid medium. Data were analyzed descriptively. Hairy roots were growing on the third week. Explants were successfully induced by strain YMB 072001 at 20, 40, and 50 minutes treatment. A4T strain was successfully induced by 10 minute of treatment. The best infection time for hairy root induction in gandarusa leaf explants for YMB 072001 strains was 20 minutes and for A4T strain was 10 minutes. Keywords: Agrobacterium rhizogenes, hairy root, infection time, Justicia gendarussa Burm. f.

Page 1 of 1 | Total Record : 5

 1 

Filter by Year

2015 2015


Reset
Filter By Issues
All Issue Vol. 15 No. 3 (2025): JURNAL BIOS LOGOS Vol. 15 No. 2 (2025): JURNAL BIOS LOGOS Vol. 15 No. 1 (2025): JURNAL BIOS LOGOS Vol. 14 No. 3 (2024): JURNAL BIOS LOGOS Vol. 14 No. 2 (2024): JURNAL BIOS LOGOS Vol. 14 No. 1 (2024): JURNAL BIOS LOGOS Vol. 13 No. 3 (2023): JURNAL BIOS LOGOS Vol. 13 No. 2 (2023): JURNAL BIOS LOGOS Vol. 13 No. 1 (2023): JURNAL BIOS LOGOS Vol. 12 No. 2 (2022): JURNAL BIOS LOGOS Vol. 12 No. 1 (2022): JURNAL BIOS LOGOS Vol 11, No 2 (2021): JURNAL BIOS LOGOS Vol. 11 No. 2 (2021): JURNAL BIOS LOGOS Vol 11, No 1 (2021): JURNAL BIOS LOGOS Vol 10, No 2 (2020): JURNAL BIOS LOGOS Vol. 10 No. 2 (2020): JURNAL BIOS LOGOS Vol 10, No 1 (2020): JURNAL BIOS LOGOS Vol 9, No 2 (2019): JURNAL BIOS LOGOS Vol 9, No 1 (2019): JURNAL BIOSLOGOS Vol 8, No 2 (2018): JURNAL BIOSLOGOS Vol 8, No 1 (2018): JURNAL BIOSLOGOS Vol 7, No 2 (2017): JURNAL BIOSLOGOS Vol 7, No 1 (2017): JURNAL BIOSLOGOS Vol 6, No 2 (2016): JURNAL BIOSLOGOS Vol 6, No 1 (2016): JURNAL BIOSLOGOS Vol 5, No 2 (2015): JURNAL BIOSLOGOS Vol 5, No 1 (2015): JURNAL BIOSLOGOS Vol 4, No 2 (2014): JURNAL BIOSLOGOS Vol 4, No 1 (2014): JURNAL BIOSLOGOS Vol 3, No 2 (2013): JURNAL BIOSLOGOS Vol 3, No 1 (2013): JURNAL BIOSLOGOS Vol 2, No 2 (2012): JURNAL BIOSLOGOS Vol 2, No 1 (2012): Jurnal Bioslogos Vol 1, No 1 (2011) More Issue