Garuda - Garba Rujukan Digital

Article Per Year (5 Year)

All

Indonesian Journal of Chemistry

ijc
Website

Published by Universitas Gadjah Mada

ISSN : 14119420 EISSN : 24601578 DOI : -

Core Subject : Science, Engineering,

Chemical Engineering, Chemistry & Bioengineering Chemistry

Indonesian Journal of Chemistry is an International, peer-reviewed, open access journal that publishes original research articles, review articles, as well as short communication in all areas of chemistry including applied chemistry. The journal is accredited by The Ministry of Research, Technology and Higher Education (RISTEKDIKTI) No : 21/E/KPT/2018 (in First Rank) and indexed in Scopus since 2012. Since 2018 (Volume 18), Indonesian Journal of Chemistry publish four issues (numbers) annually (February, May, August and November).

Arjuna Subject : -

Articles 16 Documents

1 2

Search results for , issue "Vol 11, No 3 (2011)" : 16 Documents clear

UTILIZATION OF RICE HUSK AS RAW MATERIAL IN SYNTHESIS OF MESOPOROUS SILICATES MCM-41 Suyanta Suyanta; Agus Kuncaka
Indonesian Journal of Chemistry Vol 11, No 3 (2011)
Publisher : Universitas Gadjah Mada

The research about synthesis and characterization of MCM-41 from rice husk has been done. Silica (SiO2) was extracted from rice husk by refluxing with 3M hydrochloric solution at 80 °C for 3 h. The acid-leached rice husk was filtered, washed, dried and calcined at 650 °C for 6 h lead the rough powder of rice husk silica with light brown in color. Characterization was carried out by X-ray diffraction (XRD) and FTIR spectroscopy method. Rice husk silica was dissolved into the sodium hydroxide solution leading to the solution of sodium silicate, and used as silica source for the synthesis of MCM-41. MCM-41 was synthesized by hydrothermal process to the mixture prepared from 29 g of distilled water, 8.67 g of cetyltrimethyl ammonium bromide (CTMAB), 9.31 g of sodium silicate solution, and amount mL of 1 M H2SO4. Hydrothermal process was carried out at 100 °C in a teflon-lined stainless steel autoclave heated in the oven for 36 h. The solid phase was filtered, then washed with deionised water, and dried in the oven at 100 °C for 2 h. The surfactant CTMAB was removed by calcination at 550 °C for 10 h with heating rate 2 °C/min. The as-synthesized and calcined crystals were characterized by using FTIR spectroscopy, X-ray diffraction and N2 physisorption methods. In order to investigate the effect of silica source, the same procedure was carried out by using pure sodium silicate as silica source. It was concluded that silica extracted from rice husk can be used as raw materials in the synthesis of MCM-41, there is no significant difference in crystallinity and pore properties when was compared to material produced from commercial sodium silicate.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon) Tri Joko Raharjo; Rosyida Azis Rizki; Stalis Norma Ethica; Elly Rustanti; L. Hartanto Nugroho
Indonesian Journal of Chemistry Vol 11, No 3 (2011)
Publisher : Universitas Gadjah Mada

Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS) encoding gene from melinjo plant (Gnetum gnemon L.) has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3') and GGR2 (5' CTGGATCGCACATCC TGGTG 3') primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

THE ACTIVE FRACTION FROM Nigella sativa AND ITS ACTIVITY AGAINST T47D CELL LINE Heny Ekowati; Eka Prasasti; Undri Rastuti
Indonesian Journal of Chemistry Vol 11, No 3 (2011)
Publisher : Universitas Gadjah Mada

Breast cancer is one of the main causes of death in women. Cancer treatment with surgery, chemotherapy, and radiology often cause undesirable side effects. Therefore, alternative cancer treatment by using plants as traditional medicine was expected to reduce side effects. Nigella sativa is one of the plants used as anticancer empirically. This study conducted to examine the cytotoxic activity of Nigella sativa seeds and identify its components on T47D breast cancer cells. Petroleum ether, chloroform, ethyl acetate, and ethanol were used to extract N. sativa seeds. The extracts were tested their cytotoxic activity on T47D cell line using MTT method. The active compound was separated using column chromatography. Cytotoxic test on T47D cell line was perform for extracts of each separation stage. Data were analyzed by probit analysis to obtain IC50 values. Components identification was performed using GC-MS analysis. The results showed that chloroform extract has cytotoxic activity better than other extracts with IC50 of 124.206 µg/mL. The third fraction has cytotoxic activity better than other fractions with IC50 of 68.568 µg/mL. The GC-MS analysis showed that in the third fraction of the chloroform extract contain linoleat acid, the major compound and tryptamine.

HYDROLYSIS OF CARBOHYDRATES IN CASSAVA PULP AND TAPIOCA FLOUR UNDER MICROWAVE IRRADIATION Euis Hermiati; Jun-ichi Azuma; Djumali Mangunwidjaja; Titi C. Sunarti; Ono Suparno; Bambang Prasetya
Indonesian Journal of Chemistry Vol 11, No 3 (2011)
Publisher : Universitas Gadjah Mada

Cassava pulp and tapioca flour are potential sources of glucose. In this work, validity of microwave irradiation for hydrolysis of carbohydrates, especially starch, present in cassava pulp and tapioca flour was estimated as a non-enzymatic saccharification technique. Suspension of cassava pulp or tapioca flour in distilled water (1g/20 mL) was subjected to microwave irradiation at temperatures of 140-240 °C with pre-heating time of 4 min and heating time of 5 min. Solubilization rate of cassava pulp increased with increasing temperature of microwave heating treatment and reached maximum (92.54%) at 220 °C, while that of tapioca flour reached almost 100% at 140 °C. Production of malto-oligomers from starch in cassava pulp and tapioca flour was clearly observed at 220 °C. The highest glucose yields from cassava pulp and tapioca flour in this experiment were 28.59 and 58.76% dry matter, respectively. Variation of pre-heating time at 230 °C did not give significant effects on glucose yield from cassava pulp. However, glucose yield from tapioca flour decreased due to increase of pre-heating time. Microwave irradiation is a promising method of hydrolysis for cassava pulp and tapioca flour due to the fast process.

ADSORPTION OF Ca(II), Pb(II) AND Ag(I) ON SULFONATO-SILICA HYBRID PREPARED FROM RICE HULL ASH Siti Sulastri; Nuryono Nuryono; Indriana Kartini; Eko Sri Kunarti
Indonesian Journal of Chemistry Vol 11, No 3 (2011)
Publisher : Universitas Gadjah Mada

In this research, adsorption of Ca(II), Pb(II) and Ag(I) in aqueous solution onto sulfonato-silica hybrid (SSH) prepared from rice hull ash (RHA) has been studied. The preparation of SSH adsorbent was carried out by oxidation of mercapto-silica hybrid (MSH) with hydrogen peroxide (H2O2) solution 33%. MSH was prepared, via sol-gel process, by adding 3 M hydrochloric acid solution to mixture of sodium silicate (Na2SiO3) solution and 3(trimethoxysilyl)-1-propanthiol (MPTS) to reach pH of 7.0. Solution of Na2SiO3 was generated from destruction of RHA with sodium hydroxide solution followed with heating at 500 °C for 30 min. The SSH produced was characterized with Fourier transform infrared (FTIR) spectroscopy, X-ray diffraction (XRD) analyzer, energy dispersive X-ray (EDX) spectroscopy and determination of ion-exchange capacity for sodium ion (Na+). The adsorption of Ag(I) and Ca(II) were conducted in a batch system in various concentrations for one hour. The adsorbent ion was calculated based on difference of concentrations before and after adsorption process determined using atomic absorbance spectrophotometric (AAS) method. The adsorption character was evaluated using model of isotherm Langmuir and Freundlich adsorption to calculate the capacity, constants and energy of adsorption. Result of characterization by EDX and FTIR showed qualitatively that SSH has been successfully synthesized which were indicated by appearance of characteristic absorbance of functional group namely silanol (Si-OH), siloxane (Si-O-Si), methylene (-CH2-) and disappearance of mercapto group (SH). The XRD data showed amorphous structure of SSH, similar to silica gel (SG) and MSH. The study of adsorption thermodynamics showed that oxidation of MSH into SSH increases the ion-exchange capacity for Na+ from 0.123 to 0.575 mmol/g. The change in functional group from silanol to mercapto and from mercapto to sulfonato increases the adsorption capacity of Ca(II). However, the capacity order of adsorbents for both ions of Pb(II) and Ag(I) in aqueous solution is MSH > SG > SSH.

A NEW PHENOLIC COMPOUND FROM ACETONE EXTRACT OF LICHEN Usnea flexuosa Tayl. Maulidiyah Maulidiyah; A. Herry Cahyana; Wahyudi Priyono Suwarso
Indonesian Journal of Chemistry Vol 11, No 3 (2011)
Publisher : Universitas Gadjah Mada

Natural product, 2'-hydroxy-1'-(4-hydroxyl-5-methoxy-2-methyl-phenyl)-ethanon, (1), was isolated from the thalli lichen Usnea flexuosa Tayl. together with the known (-) - usnic acid (2). The structure of compounds 1 and 2 were determined by the spectroscopic studies.

Page 2 of 2 | Total Record : 16

1 2

Filter by Year

2011 2011

Filter By Issues

All Issue Vol 26, No 1 (2026) Vol 25, No 5 (2025) Vol 25, No 4 (2025) Vol 25, No 3 (2025) Vol 25, No 2 (2025) Vol 25, No 1 (2025) Vol 24, No 6 (2024) Vol 24, No 5 (2024) Vol 24, No 4 (2024) Vol 24, No 3 (2024) Vol 24, No 2 (2024) Vol 24, No 1 (2024) Vol 23, No 6 (2023) Vol 23, No 5 (2023) Vol 23, No 4 (2023) Vol 23, No 3 (2023) Vol 23, No 2 (2023) Vol 23, No 1 (2023) Vol 22, No 6 (2022) Vol 22, No 5 (2022) Vol 22, No 4 (2022) Vol 22, No 3 (2022) Vol 22, No 1 (2022) Vol 22, No 2 (2022) Vol 21, No 6 (2021) Vol 21, No 5 (2021) Vol 21, No 4 (2021) Vol 21, No 3 (2021) Vol 21, No 2 (2021) Vol 21, No 1 (2021) Vol 20, No 6 (2020) Vol 20, No 5 (2020) Vol 20, No 4 (2020) Vol 20, No 3 (2020) Vol 20, No 2 (2020) Vol 20, No 1 (2020) Vol 19, No 4 (2019) Vol 19, No 3 (2019) Vol 19, No 2 (2019) Vol 19, No 1 (2019) Vol 18, No 4 (2018) Vol 18, No 3 (2018) Vol 18, No 2 (2018) Vol 18, No 1 (2018) Vol 17, No 3 (2017) Vol 17, No 2 (2017) Vol 17, No 1 (2017) Vol 16, No 3 (2016) Vol 16, No 2 (2016) Vol 16, No 1 (2016) Vol 15, No 3 (2015) Vol 15, No 2 (2015) Vol 15, No 1 (2015) Vol 14, No 3 (2014) Vol 14, No 2 (2014) Vol 14, No 1 (2014) Vol 13, No 3 (2013) Vol 13, No 2 (2013) Vol 13, No 1 (2013) Vol 12, No 3 (2012) Vol 12, No 2 (2012) Vol 12, No 1 (2012) Vol 11, No 3 (2011) Vol 11, No 2 (2011) Vol 11, No 1 (2011) Vol 10, No 3 (2010) Vol 10, No 2 (2010) Vol 10, No 1 (2010) Vol 9, No 3 (2009) Vol 9, No 2 (2009) Vol 9, No 1 (2009) Vol 8, No 3 (2008) Vol 8, No 2 (2008) Vol 8, No 1 (2008) Vol 7, No 3 (2007) Vol 7, No 2 (2007) Vol 7, No 1 (2007) Vol 6, No 3 (2006) Vol 6, No 2 (2006) Vol 6, No 1 (2006) Vol 5, No 3 (2005) Vol 5, No 2 (2005) Vol 5, No 1 (2005) Vol 4, No 3 (2004) Vol 4, No 2 (2004) Vol 4, No 1 (2004) Vol 3, No 3 (2003) Vol 3, No 2 (2003) Vol 3, No 1 (2003) Vol 2, No 3 (2002) Vol 2, No 2 (2002) Vol 2, No 1 (2002) Vol 1, No 3 (2001) Vol 1, No 2 (2001) Vol 1, No 1 (2001) Article in press ARTICLE IN PRESS More Issue

Home Page

OAI Link

Editorial Team

Contact

Reviewer

Google Scholar

Contact Name
-

Contact Email
-

Phone
-

Journal Mail Official
-

Editorial Address
-

Location
Kab. sleman,

Daerah istimewa yogyakarta

INDONESIA

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Home Page

OAI Link

Editorial Team

Contact

Reviewer

Google Scholar

Contact Name -

Contact Email -

Phone -

Journal Mail Official -

Editorial Address -

Location Kab. sleman, Daerah istimewa yogyakarta INDONESIA

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Contact Name
-

Contact Email
-

Phone
-

Journal Mail Official
-

Editorial Address
-

Location
Kab. sleman,

Daerah istimewa yogyakarta

INDONESIA