cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
suranto
Contact Email
editors@smujo.id
Phone
-
Journal Mail Official
editors@smujo.id
Editorial Address
unsjournals@gmail.com
Location
Kota surakarta,
Jawa tengah
INDONESIA
Biodiversitas Journal of Biological Diversity
Published by Universitas Sebelas Maret
ISSN : 1412033X     EISSN : 20854722     DOI : https://doi.org/10.13057/biodiv/d230231
Core Subject : Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology
The Biodiversitas Journal was first published in 2000 by the Department of Biology, FMNS, Universitas Sebelas Maret, Surakarta, Indonesia, then in 2006 it was co-published by the Society for Indonesian Biodiversity and that department; since 2017 it was also hosted by Smujo. From 2003-2012 it was accredited by DGHE, Ministry of Education, R.I., since 2014 was indexed by Scopus, where DOAJ and Google Scholar was indexed first.
Arjuna Subject : Biokimia, Genetika dan Biologi Molekuler - Biokimia, Genetika dan Biologi Molekuler (Lain-Lain)
Articles 64 Documents
 1   2   3   4   5 
Search results for , issue "vol. 22 no. 2 (2021)" : 64 Documents clear
Sustainability analysis of tomato jellyfish (Crambione mastigophora) fisheries resources management in Saleh Bay Waters, Sumbawa Island, Indonesia EVRON ASRIAL; MUHAMMAD MARZUKI; HAMID; ruly isfatul khasanah
Biodiversitas Journal of Biological Diversity Vol. 22 No. 2 (2021)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d220202

Abstract

Abstract. Asrial E, Marzuki M, Hamid, Khasanah RI. 2021. Sustainability analysis of tomato jellyfish (Crambione mastigophora) fisheries resources management in Saleh Bay Waters, Sumbawa Island, Indonesia. Biodiversitas 22: 512-520. The tomato jellyfish (Crambione mastigophora) or gullung (local term), is endemic in Saleh Bay, Sumbawa Island, Indonesia and has been utilized as an additional livelihood by fishermen for last two decades. Its commonly caught by 2-4 fishermen/boat using scoop net, wooden fishing vessels, and lamps as attractors and collectors of jellyfish. This study aims to determine the sustainability of jellyfish fisheries management. A survey-dependent method with sampling, observation, dialogue, and documentation techniques was applied for data compilation. The rapid appraisal for jellyfish fisheries - six dimensions (Rapjellyfish-6D), based on Rapfish technique, is utilized for analysis of the sustainability status of jellyfish fisheries management. This paper describes the sustainability analysis results for two of the six dimensions of jellyfish fisheries management, namely the technological dimension (13 attributes) as an input factor and the economic dimension as an output factor (14 attributes). At present, around 8-30 baskets/boat/day of jellyfish mouth-arms are being sold to the buyers in Saleh Bay. This catch's profit is divided between the fishermen (3 parts) and the boat owner (2 parts). The analytical results show the revenue per cost ratio (R/C Ratio) as 4.75 which means that every 1.00 Indonesian Rupiah (IDR) the cost of catching jellyfish will generate IDR 4.75. The breakeven point (BEP)Price is IDR 13,158 and BEPProduction is 3.13 and 8.33 baskets/trip for the assumed price of IDR 80,000 and IDR 30,000. The technological (36.13%) sustainability status and economic (49.64%) dimension is Less Sustainable. The leverage analysis results indicate that the group of sensitive attributes in the technological and economic dimensions, respectively, consists of 5 attributes and 3 attributes. All sensitive attributes have an impact on the low value of management sustainability. The sustainability of jellyfish fisheries management in Saleh Bay has been supported by a choice of environmentally friendly fishing methods. Besides, the mouth-arm price is formed from an oligopsony market system that is not profitable for fishermen. It is suggested to the village government to build an integrated and environmentally friendly scyphozoan facility to neutralize the liquid waste generated from scyphozoan processing.
Genetic differentiation of dengue vector Aedes aegypti in the small geographical scale of Banyumas District, Indonesia based on Cytochrome Oxidase I Mohammed A. Mohammed; Agus Nuryanto; Endang Srimurni K Kusmintarsih
Biodiversitas Journal of Biological Diversity Vol. 22 No. 2 (2021)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d220219

Abstract

Abstract. Mohammed MA, Nuryanto A, Kusmintarsih ES. 2021. Genetic differentiation of dengue vector Aedes aegypti in the small geographical scale of Banyumas District, Indonesia based on Cytochrome Oxidase I. Biodiversitas 22: 675-683. Aedes aegypti (Linnaeus, 1762) is a major vector of arboviruses. Currently, Ae. aegypti is spreading throughout the Banyumas District, Central Java, Indonesia and there is little information regarding the genetic variation of this species, yet the information is essential to develop effective vector control measures. The aims of this study was to evaluate the genetic differentiation of Ae. aegypti populations in South Purwokerto and Cilongok subdistricts. Mosquito larvae were collected using oviposition traps inside houses in South Purwokerto and Cilongok (Jastaba village). Twenty larvae of Ae. aegypti, ten from each location were identified and used for genetic analysis. Analysis of mitochondrial cytochrome Oxidase I (mtCOI) produced around 600 bp fragments, detecting ten haplotypes. The haplotype diversity and nucleotide diversity indices were higher in South Purwokerto samples. Tajima and Fu’s statistics indicated that the sampled populations were in genetic equilibrium. Indices of demographic history were fit for a spatial expansion model. Higher genetic variation was observed within the population compared to between the populations. Furthermore, strong genetic difference was detected between the two populations, with highly significant FS (p < 0.0001). Weak haplotype sharing occurred between the two populations assuming that the gene flow was facilitated by human transportation. All haplotypes were a cluster of single clades and closely related to haplotypes generated from previous studies in Central Java.
Freshwater pond microalgae for biofuel: Strain isolation, identification, cultivation and fatty acid content Bayu Afnovandra Perdana; Abdi Dharma; Indra Junaidi Zakaria; Syafrizayanti SYAFRIZAYANTI
Biodiversitas Journal of Biological Diversity Vol. 22 No. 2 (2021)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d220201

Abstract

Abstract. Perdana BA, Dharma A, Zakaria IJ, Syafrizayanti. 2021. Freshwater pond microalgae for biofuel: Strain isolation, identification, cultivation, and fatty acid content. Biodiversitas 22: 505-511. Microalgae have capability to produce fatty acid for biofuel, drugs, and nutraceutical foods development. This study was carried out to obtain a new strain candidate for fatty acid production. The methods were used in this study include isolation of microalgae species from freshwater ponds of Andalas University, Padang, Indonesia. Molecular identification of microalgae was carried out with specific 18S rRNA primer, F-P73, and R-P47. Microalgae growth was measured by cell density and optical density method using various wavelengths (400, 500, and 680 nm). Total lipid was extracted using Bligh & Dyer method. Fatty acid analyses were conducted using gas chromatography-mass spectroscopy. Microalgae were isolated i.e Chlorella emersonii MAUA001, Mychonastes rotundus MAUA002, Scenedesmus dimorphus MAUA003, and Scenedesmus armatus MAUA004. The result exhibited M. rotundus was the highest lipid content, it was about 28.8% biomass weight. Fatty acid profiles of microalgae were dominated by monounsaturated (MUFA) and saturated fatty acid (SFA). The highest content of fatty acid species found in C. emersonii with octadecenoic acid (C18:1) was 47.74% total lipid. This work showed that C. emersonii has potential as biodiesel due to high saturated fatty acid.
Short communication: Savanna-forest boundary on Mount Rinjani, Lombok Island, West Nusa Tenggara, Indonesia Sutomo SUTOMO; Eddie van Etten; Rajif Iryadi
Biodiversitas Journal of Biological Diversity Vol. 22 No. 2 (2021)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d220225

Abstract

Abstract. Sutomo, van Etten E, Iryadi R. 2021. Short communication: Savanna-forest boundary on Mount Rinjani, Lombok Island, West Nusa Tenggara, Indonesia. Biodiversitas 22: 726-731. Seasonally dry tropical forests tend to be bordered by or are mixed with savanna ecosystems. This research investigates the location and nature of forest-savanna boundary on Mt. Rinjani and hypothesizes on potential causes of such boundary formation. The field survey locations were based on MODIS burnt area data. We made 30 plots (50 x 50 m) established along transects to obtain vegetation and environment data across boundaries. For data analysis, we use community correspondence index (CCI), vegetation composition using Importance Value Index (IVI), and Analysis of Similarity (ANOSIM) to detect differences in floristic and environmental characteristics across boundaries. Species composition in the transition zone (based on highest IVI results) comprises Ficus septica, Macaranga tanarius, Lindera sp., Engelhardia spicata, Saurauria sp., Rytidosperma penicillatum, and Athyrium sp. The Non-Metric Multi-Dimensional Scaling (NMDS) based on environmental data showed clear separation between savanna and forest, although boundaries were floristically similar to forest. Micro- and macro-environmental factors, as well as, fire disturbances, are also important features of the forest-savanna boundary on Mt. Rinjani. We present evidence of boundary dynamics in the form of forest advance on the Mt. Rinjani south-west slope.
Vegetation structure of Sumatran Orangutan (Pongo abelii) habitat in North Sumatra, Indonesia Anita Zaitunah; SAMSURI; Satia Ras
Biodiversitas Journal of Biological Diversity Vol. 22 No. 2 (2021)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d220215

Abstract

Abstract. Zaitunah A, Samsuri, Ras S. 2021. Vegetation structure of Sumatran Orangutan (Pongo abelii) habitat in North Sumatra, Indonesia. Biodiversitas 22: 635-641. Gunung Leuser National Park forest in the Bukit Lawang section is the habitat of Sumatran Orangutan (Pongo abelii). There have been reports of the orangutans visiting the village. As some tree species are required for their sustenance to provide nests and food, there is a need to study species diversity availability in their habitat. Thus, the aim of the research was to analyze the composition and structure of the area's vegetation-this was done for the forestand mixed plantation. The sampling for the measurement of tree parameters was conducted using the line strip method. The strips (width 50 m, length 250 m) were constituted by a sub-plot measuring for seedling, pole, sapling, and trees. Within the sampling area, 181 species were found. Species within Dipterocarpaceae showed higher important value index (IVI) compared to other species in all layers. Shorea parviflora and Shorea ovalis were among the species with higher IVI in all the layers. The presence of species of Dipterocarpaceae and other species preferred by orangutans will support their quality of life. Therefore, orangutans prefer staying in the forest to entering the garden. Thus, it is concluded that their entry into the mixed gardens is related to the garden's proximity to the forest. Conservation efforts are needed to minimize the conflict between man and orangutan in the surrounding area.
Short Communication: Molecular study on mt-DNA COX2 gene of Sumatran elephant (Elephas maximus sumatranus) Deny Setyo Wibowo; Rini Widiyanti; Machmud Asvan; Prista Dwi Restanti; Hery Wijayanto
Biodiversitas Journal of Biological Diversity Vol. 22 No. 2 (2021)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d220263

Abstract

Abstract. Wibowo DS, Widiyanti R, Asvan M, Restanti PD, Wijayanto H. 2021. Short Communication: Molecular study on mt-DNA COX2 gene of Sumatran elephant (Elephas maximus sumatranus). Biodiversitas 22: 1063-1068. Sumatran elephant is the only subspecies of Asian elephants that receives a critically endangered status from the International Union for Conservation and Nature Resources (IUCN). Identifying the genetic marker of Sumatran elephants is, therefore, important for their conservation. This study aimed to identify the Sumatran elephant based on specific mitochondrial DNA markers of the Cytochrome c oxidase subunit II (COX2) gene. It is an exploratory research considering the limited data and research about the genetic, especially the COX2 of Sumatran elephant (Elephas maximus sumatranus). Forward and reverse sequencing of PCR products was conducted using the primary COX2 from Sumatran elephant samples. The results of the subsequent gene sequencing were aligned with the sequences of other Asian elephants from Genbank using Clustal W software and analyzed using the MEGA program version 6.06. The analysis of genetic distance based on COX2 constituent nucleotides calculated with Kimura’s two-parameter method showed that the genetic distance between Elephas maximus sumatranus and Elephas maximus outside of Sumatra was 0.25%. The phylogenetic trees analyzed using the maximum-likelihood based on nucleotide sequences showed a high homogeneity. The ratio of Elephas maximus sumatranus with Elephas maximus shows levels of nucleotide mutations which are nine nucleotides and four nucleotides. These results indicated that the COX2 gene could not identify the individual species of Sumatran elephant because of the high intraspecies homogeneity, but it detected the interspecies divergence clustered in Asian elephant clade.
Identification of fermentative bacteria on local microorganisms of golden snail (Pomacea canaliculata Lamarck, 1822) YULIANA RETNOWATI; Abubakar Sidik Katili
Biodiversitas Journal of Biological Diversity Vol. 22 No. 2 (2021)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d220231

Abstract

Abstract. Retnowati Y, Katili AS. 2021. Identification of fermentative bacteria on local microorganisms of golden snail (Pomacea canaliculate Lamarck, 1822). Biodiversitas 22: 778-784. Local Microorganisms (LMo) is a fermented liquid containing various microorganisms that potentially act as decomposers and bio-fertilizer. P. canaliculata is one of the rice pests that is a basic ingredient of LMo because of its high protein content. The objective of this study was to determine the types of fermentative bacteria on Local Microorganisms of P. canaliculata. The fermentation of LMo was conducted for 0, 7, 14, and 21 days. Microbial population was determined at 7-day intervals based on the TPC method. Characterization and identification based on polyphasic taxonomy including macroscopic and microscopic morphological characters., Molecular identification was based on 16S rRNA gene sequences. The results showed that LMo of P. canaliculata had a low degree of acidity and tended to decrease during the incubation period, from pH 5.3 to 4.0. Bacterial population tends to increase at 0-14 fermentation days and decreases after 21 days. The isolation results showed that the 3 bacterial isolates namely BFPc-01, BFPc-02, and BFPc-03 were isolated based on morphological differences. The morphological characters of BFPc-01 was milky white color colony, Gram-negative, coccus; BFPc-02 isolate was pink, colony color, Gram-negative, coccus; and BFPc-03 isolate was yellow color colony, bacillus, Gram-positive. The results of molecular characterization based on the 16s rRNA gene sequence showed that BFPc-01 isolate similar to Klebsiella pneumoniae MT604895.1 (99.04%), BFPc-02 isolate closely related to Serratia sp. (100%), and BFPc-03 isolate similar to Microbacterium  sp. (100%).
Identification of Drought Tolerant and Molecular Analysis of DREB2A and BADH2 Genes and Yield Potensial of Lines from Single Crossing Bengkulu Local Rice Varieties Reny Herawati; ALNOPRI ALNOPRI; MASDAR MASDAR; MARULAK SIMARMATA; SIPRIYADI SIPRIYADI; MIMI SUTRAWATI
Biodiversitas Journal of Biological Diversity Vol. 22 No. 2 (2021)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d220232

Abstract

Screening in the seedling stage of 39 progeny of F6 lines to drought stress was carried out in the greenhouse.  Drought tolerant and sensitive varieties of IR 20 and Salumpikit, respectively, were used as control plants.  The methods for traits identification of leaf curled, dried, and recovery ability after exposure to severe drought for two weeks was following the Standard Evaluation System (SES) developed by IRRI.  Molecular analysis to detect the presence of the DREB2A gene was carried out by PCR amplification of genomic DNA using forward- and reverse- oligonucleotide primers of CCTCATTGGGTCAGGAAGAA and GGATCTCAGCCACCCACTTA, respectively, while for BADH2 gene using forward- and reverse- oligonucleotide primers of GGCCAAGTACCTCAAGGCGA and TGTCCCCAGCTGCTTCATCC, respectively.  Molecular markers of DREB2A and BADH2 genes were also identified in 39 tested lines with approximately 250 and 2300 bp length, respectively.  This study concluded that the progeny of F6 lines generating from the crossing of local varieties of IR7858 and IR148 is the potential to become a drought-tolerant variety of upland rice. Line numbers BKL2 B-2-264-6 and BKL4 B-1-268-10 have a potential yield of more than 12 tonnes/ha. These line has the potential to be developed on rainfed lowland rice or dry land because it has drought resistance.
DNA intensity and genetic diversity of oil palm (Elaeis guineensis) to determine an elite low lipase line Nina Unzila Angkat; LUTHFI AZIZ MAHMUD SIREGAR; Mohammad Basyuni; Dadang Afandi; INDRA SYAHPUTRA
Biodiversitas Journal of Biological Diversity Vol. 22 No. 2 (2021)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d220245

Abstract

Abstract. Angkat NU, Siregar LAM, Basyuni M, Afandi D, Syahputra I. 2021. DNA intensity and genetic diversity of oil palm (Elaeis guineensis) to determine an elite low lipase line. Biodiversitas 22: 900-905. The acidification of palm oil due to lipase activity in the mesocarp is assessed under genetic control. Three molecular markers have been established to gauge the lipase gene in oil palm. Lower lipase activity is desired for good quality edible oil. This study aims to identify the genetic diversity by screening groups/families to determine an elite low lipase genotype of oil palm. Genetic diversity and population structure of 15 groups of oil palm were investigated by using three specific markers with GenAlex 6.502 software. Results show that the Polymorphic Informative Content (PIC) value of markers was around 0,985-0,993, which indicates that these markers are effective in determining the diversity of lipase activity in oil palm. Analysis of molecular variance (AMOVA) revealed that genetic diversity varies within individuals (54%), among individuals (31%), and among population (15%). The value of number of alleles (Na), number of effective alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He), and number of allele migration (Nm) indicate that the genetic diversity in this population is relatively low. Phylogenetic analysis identified two main groups as high lipase and low lipase activity groups based on DNA intensity.
The role of bacterial symbionts in the biodegradation of chlorpyrifos in the digestive tract of Plutella xylostella larvae Mochammad Syamsul Hadi; ABDUL LATIEF ABADI; TOTO HIMAWAN; MASRURI MASRURI; SAFIRA RIZKA LESTARI; BAMBANG TRI RAHARDJO; LUQMAN QURATA AINI; YOGO SETIAWAN; HAGUS TARNO
Biodiversitas Journal of Biological Diversity Vol. 22 No. 2 (2021)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d220222

Abstract

Abstract. Hadi MS, Abadi AL, Himawan T, MAsruri, Lestari SR, Rahardjo BT, Aini LQ, Setiawan Y, Tarno H. 2021. The role of bacterial symbionts in the biodegradation of chlorpyrifos in the digestive tract of Plutella xylostella larvae. Biodiversitas 22: 702-712. Several species in the order Lepidoptera act as plant pests, one of which is Plutella xylostella. Plutella xylostella is one of the most destructive pests of cabbage and other horticultural crops. The use of chemical insecticides as pest control for P. xylostella causes many problems, such as the increased pest resistance to pesticides. The objectives of this study are:  (i) to obtain and characterize symbiont bacteria in the digestive tract of P. xylostella collected from organic and conventional agriculture soils; (ii) to evaluate the potential of bacterial symbionts in the digestive tract of P. xylostella from organic and conventional soils in degrading the active ingredient of chlorpyrifos insecticide; (iii) To determine the biodegradation process of chlorpyrifos insecticide by symbiont bacteria in the digestive tract of P. xylostella; and (iv) to identify the derivative compounds from the biodegradation of chlorpyrifos insecticide. The results showed 30 symbiont bacteria isolated from the digestive tract of P. xylostella collected from organic soil and 36 symbiont bacteria isolated from the digestive tract of P. xylostella from conventional farming soil. There are 15 species of symbiont bacteria in 5 genera from the digestive tract of P. xylostella from organic and conventional farming capable of degrading the chlorpyrifos insecticide. They are identified as Providencia sp., Pseudomonas sp., Serratia sp., Proteus sp., and Aeromonas sp. Chlorpyrifos-derived compounds from the biodegradation of symbiont bacteria are less toxic than chlorpyrifos compounds.

Page 1 of 7 | Total Record : 64

 1   2   3   4   5 

Filter by Year

2021 2021


Reset
Filter By Issues
All Issue Vol. 27 No. 8 (2026) Vol. 27 No. 7 (2026) Vol. 27 No. 6 (2026) Vol. 27 No. 5 (2026) Vol. 27 No. 4 (2026) Vol. 27 No. 3 (2026) Vol. 27 No. 2 (2026) Vol. 27 No. 1 (2026) Vol. 26 No. 12 (2025) Vol. 26 No. 11 (2025) Vol. 26 No. 10 (2025) Vol. 26 No. 9 (2025) Vol. 26 No. 8 (2025) Vol. 26 No. 7 (2025) Vol. 26 No. 6 (2025) Vol. 26 No. 5 (2025) Vol. 26 No. 4 (2025) Vol. 26 No. 3 (2025) Vol. 26 No. 2 (2025) Vol. 26 No. 1 (2025) Vol. 25 No. 12 (2024) Vol. 25 No. 11 (2024) Vol. 25 No. 10 (2024) Vol. 25 No. 9 (2024) Vol. 25 No. 8 (2024) Vol. 25 No. 7 (2024) Vol. 25 No. 6 (2024) Vol. 25 No. 5 (2024) Vol. 25 No. 4 (2024) Vol. 25 No. 3 (2024) Vol. 25 No. 2 (2024) Vol. 25 No. 1 (2024) Vol. 24 No. 12 (2023) Vol. 24 No. 11 (2023) Vol. 24 No. 10 (2023) Vol. 24 No. 9 (2023) Vol. 24 No. 8 (2023) Vol. 24 No. 7 (2023) Vol. 24 No. 6 (2023) Vol. 24 No. 5 (2023) Vol. 24 No. 4 (2023) Vol. 24 No. 3 (2023) Vol. 24 No. 2 (2023) Vol. 24 No. 1 (2023) Vol. 23 No. 12 (2022) Vol. 23 No. 11 (2022) Vol. 23 No. 10 (2022) Vol. 23 No. 9 (2022) Vol. 23 No. 8 (2022) Vol. 23 No. 7 (2022) Vol. 23 No. 6 (2022) Vol. 23 No. 5 (2022) Vol. 23 No. 4 (2022) Vol. 23 No. 3 (2022) Vol. 23 No. 2 (2022) Vol. 23 No. 1 (2022) Vol. 22 No. 12 (2021) Vol. 22 No. 11 (2021) Vol. 22 No. 10 (2021) Vol. 22 No. 9 (2021) Vol. 22 No. 8 (2021) Vol. 22 No. 7 (2021) Vol. 22 No. 6 (2021) Vol. 22 No. 5 (2021) Vol. 22 No. 4 (2021) Vol. 22 No. 3 (2021) Vol. 22 No. 2 (2021) Vol. 22 No. 1 (2021) Vol. 21 No. 12 (2020) Vol. 21 No. 11 (2020) Vol. 21 No. 10 (2020) Vol. 21 No. 9 (2020) Vol. 21 No. 8 (2020) Vol. 21 No. 7 (2020) Vol. 21 No. 6 (2020) Vol. 21 No. 5 (2020) Vol. 21 No. 4 (2020) Vol. 21 No. 3 (2020) Vol. 21 No. 2 (2020) Vol. 21 No. 1 (2020) Vol. 20 No. 12 (2019) Vol. 20 No. 11 (2019) Vol. 20 No. 10 (2019) Vol. 20 No. 9 (2019) Vol. 20 No. 8 (2019) Vol. 20 No. 7 (2019) Vol. 20 No. 6 (2019) Vol. 20 No. 5 (2019) Vol. 20 No. 4 (2019) Vol. 20 No. 3 (2019) Vol. 20 No. 2 (2019) Vol. 20 No. 1 (2019) Vol. 19 No. 6 (2018) Vol. 19 No. 5 (2018) Vol. 19 No. 4 (2018) Vol. 19 No. 3 (2018) Vol. 19 No. 2 (2018) Vol. 19 No. 1 (2018) Vol. 18 No. 4 (2017) Vol. 18 No. 3 (2017) Vol. 18 No. 2 (2017) Vol. 18 No. 1 (2017) Vol. 17 No. 2 (2016) Vol. 17 No. 1 (2016) Vol. 16 No. 2 (2015) Vol. 16 No. 1 (2015) Vol. 15 No. 2 (2014) Vol. 15 No. 1 (2014) Vol. 14 No. 2 (2013) Vol. 14 No. 1 (2013) Vol. 13 No. 4 (2012) Vol. 13 No. 3 (2012) Vol. 13 No. 2 (2012) Vol. 13 No. 1 (2012) Vol. 12 No. 4 (2011) Vol. 12 No. 3 (2011) Vol. 12 No. 2 (2011) Vol. 12 No. 1 (2011) Vol. 11 No. 4 (2010) Vol. 11 No. 3 (2010) Vol. 11 No. 2 (2010) Vol. 11 No. 1 (2010) Vol. 10 No. 4 (2009) Vol. 10 No. 3 (2009) Vol. 10 No. 2 (2009) Vol. 10 No. 1 (2009) Vol. 9 No. 4 (2008) Vol. 9 No. 3 (2008) Vol. 9 No. 2 (2008) Vol. 9 No. 1 (2008) Vol. 8 No. 4 (2007) Vol. 8 No. 3 (2007) Vol. 8 No. 2 (2007) Vol. 8 No. 1 (2007) Vol. 7 No. 4 (2006) Vol. 7 No. 3 (2006) Vol. 7 No. 2 (2006) Vol. 7 No. 1 (2006) Vol. 6 No. 4 (2005) Vol. 6 No. 3 (2005) Vol. 6 No. 2 (2005) Vol. 6 No. 1 (2005) Vol. 5 No. 2 (2004) Vol. 5 No. 1 (2004) Vol. 4 No. 2 (2003) Vol. 4 No. 1 (2003) Vol. 3 No. 2 (2002) Vol. 3 No. 1 (2002) Vol. 2 No. 2 (2001) Vol. 2 No. 1 (2001) Vol. 1 No. 2 (2000) Vol. 1 No. 1 (2000) More Issue