cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
suranto
Contact Email
editors@smujo.id
Phone
-
Journal Mail Official
editors@smujo.id
Editorial Address
unsjournals@gmail.com
Location
Kota surakarta,
Jawa tengah
INDONESIA
Biodiversitas Journal of Biological Diversity
Published by Universitas Sebelas Maret
ISSN : 1412033X     EISSN : 20854722     DOI : https://doi.org/10.13057/biodiv/d230231
Core Subject : Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology
The Biodiversitas Journal was first published in 2000 by the Department of Biology, FMNS, Universitas Sebelas Maret, Surakarta, Indonesia, then in 2006 it was co-published by the Society for Indonesian Biodiversity and that department; since 2017 it was also hosted by Smujo. From 2003-2012 it was accredited by DGHE, Ministry of Education, R.I., since 2014 was indexed by Scopus, where DOAJ and Google Scholar was indexed first.
Arjuna Subject : Biokimia, Genetika dan Biologi Molekuler - Biokimia, Genetika dan Biologi Molekuler (Lain-Lain)
Articles 50 Documents
 1   2   3   4   5 
Search results for , issue "vol. 25 no. 1 (2024)" : 50 Documents clear
Population study of Cucurbita moschata based on morphological characters and isozyme banding patterns in Bima District, West Nusa Tenggara, Indonesia MUHAMMAD FURQAN; SURANTO SURANTO; SUGIYARTO SUGIYARTO
Biodiversitas Journal of Biological Diversity Vol. 25 No. 1 (2024)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d250104

Abstract

Abstract. Furqan M, Suranto, Sugiyarto. 2023. Population study of Cucurbita moschata based on morphological characters and isozyme banding patterns in Bima District, West Nusa Tenggara, Indonesia. Biodiversitas 25: 30-38. Pumpkin is a tropical plant that benefits from its lipid, protein, carbohydrate, and mineral contents. The morphological characters of pumpkins can be influenced by their genetics and environment. This research aimed to examine the relationship among 9 accessions of Cucurbita moschata Duchesne from 9 locations in Bima district, West Nusa Tenggara (NTB) province, Indonesia. The morphological characters of stems, leaves, and flowers were analyzed qualitatively and quantitatively and an ANOVA was used to look at the difference of leaf and flower characters. Polyacrylamide gel electrophoresis (PAGE) with peroxidase and esterase was used to detect isozyme banding patterns. Morphological characters and isozyme data were analyzed using a UPGMA method with NTSYS version 2.0 software to construct a dendrogram. The results show evidence of the varied morphological appearance of C. moschata from the different locations. A total of 12 esterase bands and 10 peroxidase bands were detected from Wera2. An undetected band with Rf value of 0.567 was recorded, while a unique band with Rf value of 0.133 (peroxidase) was not detected. Undetected bands with Rf values of 0.645 and 0.726 of esterase were also recorded.  A dendrogram showed three clusters of 9 accessions studied, in which Wera2 and Wera3 each stood alone, and a third large group was formed from the 7 remaining accessions. These results confirm the uniqueness of the Wera2 and Wera3 accessions. These results would be good information in determining a management strategy for improving the quality of pumpkins in the future.
Plant biodiversity and people’s behavior on environmental conservation in Pabelan Islamic Boarding School, Magelang, Central Java, Indonesia IRFAN ABU NAZAR; SUTARNO SUTARNO; MUDOFIR MUDOFIR; SUNARTO SUNARTO
Biodiversitas Journal of Biological Diversity Vol. 25 No. 1 (2024)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d250126

Abstract

Abstract. Nazar IA, Sutarno, Mudofir, Sunarto. 2024. Plant biodiversity and people’s behavior on environmental conservation in Pabelan Islamic Boarding School, Magelang, Central Java, Indonesia. Biodiversitas 25: 232-239. Pabelan Islamic Boarding School is a modern educational institution committed to religious-based environmental education. The landscape of this Islamic boarding school is designed to contribute to the preservation of the surrounding environment. This study aims to determine plant diversity and behavioral patterns in environmental conservation in Pabelan Islamic Boarding School, Magelang District, Central Java, Indonesia. Vegetation analysis was conducted by inventory of tree species planted in the area of the school. Analysis of the behavior patterns was carried out using observation, interviews with the clerics (kiai), teacher (ustaz) and staff, and questionnaires to students. The result of vegetation analysis showed that Pabelan Islamic boarding school has a moderate level of flora diversity with a Shannon-Wiener index (H’: 2.597). This is because the management of the school has a unique way of maintaining flora biodiversity by requiring every new student to bring unique or rare plant seeds from their hometown. The Kiai and teacher at the school have progressive thoughts about the human's relationship with God and nature. Human is God's representative who is obliged to maintain the environment and natural elements including biodiversity. The students generally have adequate awareness and concern for the environment and sustainability which is largely influenced by the figure of the Kiai. The findings of this study imply that Islamic boarding school (pesantren) can play essential role in practicing and raising awareness of sustainable environmental management and biodiversity conservation.
Biodiversity of hydrolytic enzymes-producing soil bacteria from a Durian Park, Jombang, Indonesia: Beneficial prospect for sustainable agriculture NI’MATUZAHROH NI’MATUZAHROH; MOCH. AFFANDI; AGUS SUPRIYANTO; BERLIAN RUSTANTINA; LAILY AINUN JAIYAH; AISYAH RAHMAWATI; HESTI NURHAYATI; SILVIA KURNIA SARI; ANA MARIATUL KHIFTIYAH; DAMAN HURI
Biodiversitas Journal of Biological Diversity Vol. 25 No. 1 (2024)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d250146

Abstract

Abstract. Ni’matuzahroh, Affandi M, Supriyanto A, Rustantina B, Jaiyah LA, Rahmawati A, Nurhayati H, Sari SK, Khiftiyah AM, Huri D. 2024. Biodiversity of hydrolytic enzymes-producing soil bacteria from a Durian Park, Jombang, Indonesia: Beneficial prospect for sustainable agriculture. Biodiversitas 25: 392-403. Biofertilizer is an alternative to chemical fertilizer that can enhance plant growth but is specific to certain plants and soils. Various biofertilizers have been produced, but the specific biofertilizers to enhance durian growth have not been widely available. This study aims to determine the potential of hydrolytic enzyme-producing bacteria, one of the microbial components of biofertilizers, in the De Durian Park (DDP) area, Wonosalam, Jombang District, Indonesia. The bacteria were isolated using the selective medium plating technique. The obtained isolates were screened for their ability to produce cellulase, amylase, protease, and lipase. The clear zone around the colony indicated the ability of the isolates to produce hydrolytic enzymes, and then the clear zone index was obtained. The best three isolates for each enzyme production were characterized macroscopically, microscopically, and biochemically, then identified using 16S rRNA gene sequence analysis. Fifty-two isolates were successfully obtained from the soil of DDP. The best three cellulolytic bacteria had indices ranging from 1.83 to 2.14, categorized as moderate-strong, identified as Bacillus anthracis, B. pacificus, and B. cereus. The amylolytic bacteria ranged from 1.25 to 1.35, categorized as moderate, and identified as Bacillus anthracis, B. paranthracis, and B. paramycoides. The proteolytic bacteria ranged from 1.33 to 1.50, categorized as moderate, identified as B. pumilus, B. paramycoides, and B. cereus. The lipolytic bacteria ranged from 1.94 to 3.87, categorized as moderate-strong, and were identified as Enterobacter sichuanensis, B. pacificus, and E. asburiae. These cellulolytic, amylolytic, proteolytic, and lipolytic bacteria have the potency as candidates for a biofertilizer formula.
Phytochemical analysis and antioxidant activities ethanol extract of propolis Trigona spp. from different vegetation in Lombok, West Nusa Tenggara, Indonesia KUNTI TIRTASARI; LUCIA TRI SUWANTI; MUFASIRIN MUFASIRIN; POEDJI HASTUTIEK; ELLY NUR INDASARI; ROCHMAH KURNIJASANTI; HANI PLUMERIASTUTI; ERMA SAFITRI; EKA PRAMYRTHA HESTIANAH
Biodiversitas Journal of Biological Diversity Vol. 25 No. 1 (2024)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d250147

Abstract

Abstract. Tirtasari K, Suwanti LT, Mufasirin, Hastutiek P, Indasari EN, Kurnijasanti R, Plumeriastuti H, Safitri E, Hestianah EP. 2024. Phytochemical analysis and antioxidant activities ethanol extract of propolis Trigona spp. from different vegetation in Lombok, West Nusa Tenggara, Indonesia. Biodiversitas 25: 404-411. Propolis is a natural substance containing a resin that is collected by honey bees from various plants and has a significant effect on human health such as antibacterial, antifungal, anti-inflammatory, antiviral, anesthetic, antioxidant, antitumoural, antiprotozoal, anticancer, antihypertensive, anticarcinogenic, antihepatotoxic and has cytotoxic activity. Cultivation of Trigona spp. in Lombok is growing rapidly. Trigona spp. produces more propolis than honey bees of Apis spp., but bee products that are maximally utilized are only honey, and propolis has not been utilized optimally. Currently, there is no scientific validation of the phytochemical content, bioactive compounds, and biological activities of ethanol extract propolis Trigona spp. from Lombok, West Nusa Tenggara. So, this study aimed to determine the phytochemical compounds, bioactive compounds, and antioxidant activity of propolis. Gas Chromatography-Mass Spectrometry (GC-MS) analysis was performed to determine the bioactive compounds of ethanol extract propolis. DPPH (2,2-diphenyl-1-picrylhydrazyl) was used to evaluate antioxidant activity. The composition of propolis compounds is different for each propolis depending on the bee species and the vegetation source from which the resin was collected. In this research, propolis was collected from different vegetation sources (cashews, moringa, coffee, and lote trees). This study used qualitative and quantitative phytochemical analysis and the antioxidant DPPH test. Different components and percentages cause significant variations in the results obtained from phytochemical tests. The content is different in various propolis, there are saponins, flavonoids, and tannins. The highest antioxidant activity was found in propolis with moringa resin 38.4150 (very strong), followed by lote tree resin -66.0420 (strong), cashew resin 81.8140 (strong), and coffee resin 100.7465 (moderate).
Examining the effectiveness of bored pile coral for coral rehabilitation NOVITA PERMATA PUTRI; MUHAMMAD RIFAT MUHARAM; ABDULRAHMAN RITONGA; CORINA DEWI RUSWANTI; DIAN ARTHEN; MUNASIK MUNASIK
Biodiversitas Journal of Biological Diversity Vol. 25 No. 1 (2024)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d250117

Abstract

Abstract. Putri NP, Muharam MR, Ritonga A, Ruswanti CD, Arthen D, Munasik. 2024. Examining the effectiveness of bored pile coral for coral rehabilitation. Biodiversitas 25: 153-161. Semut Island is located in Kiabu Village, Anambas Islands, Riau, Indonesia, and has suffered significant damage to its coral cover due to blast fishing. To address this issue, Anambas Foundation initiated a coral reef rehabilitation on Semut Island using a customized artificial reef called Bored Pile Coral (BPC), a cylindrical structure made of concrete hammered into the seabed. This research aims to examine the effectiveness of BPC by monitoring its performance. Therefore, from February 2022 to January 2023, 1,500 BPCs were deployed and attached with corals covering an area of 170 m2. We quantified five ecological indicators, i.e., coral cover, survival rate, recruitment, growth rates, and fish biomass. Results showed an increase in coral cover from 3.8% to 8%. The survival rate was 64%, and the mean monthly growth rates varied among three genera: Pocillopora sp. (0.235±0.02 month-1), Acropora sp. (0.22±0.03 month-1) and Porites sp. (0.08±0.02 month-1). The monthly mean fish biomass data showed the biomass was 427,25 Kg/Ha and increased 3,9 times since the beginning of the research. BPC's structure has been proven to act as stable media for hard corals, although the modification may be necessary to enhance structural complexity and suitability for carnivorous fish habitats.
Assessment of the dynamic growth and potassium solubilization capability of three novel bacteria IMAM HARTONO BANGUN; BUNGA RAYA KETAREN; ASRITANARNI MUNAR; PERDINANTA SEMBIRING; NURHAJIJAH NURHAJIJAH; ANDRI ABDI; REYZA SUWANTO SITORUS
Biodiversitas Journal of Biological Diversity Vol. 25 No. 1 (2024)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d250120

Abstract

Abstract. Bangun IH, Ketaren BR, Munar A, Sembiring P, Nurhajijah, Abdi A, Sitorus RS. 2024. Assessment of the dynamic growth and potassium solubilization capability of three novel bacteria. Biodiversitas 25: 177-185. Clay minerals are essential components that play a crucial role in soil cation exchangeable capacity and optimal plant growth. These components, including potassium (K), have the ability to bind with mineral crystals in the soil. Several studies have shown that K-solubilizing bacteria can facilitate the solubility of potassium, leading to optimal availability. However, the use of bacteria as biofertilizers is still limited due to challenges related to survival and growth patterns. To address these challenges, it is important to monitor the growth of the microbes and enhance their selection process to achieve effective utilization. Therefore, this study aimed to determine the bacterial growth dynamics and potential of Burkholderia paludis IHB_01, Burkholderia cepacia IHB_02, and Paraburkholderia phymatum IHB_03 in enhancing soil cation availability on clay minerals. The results showed a common initial adaptation phase among the 3 bacterial strains, followed by distinct exponential growth patterns. Burkholderia cepacia IHB_02 had the longest exponential growth phase, showing efficient resource utilization and extended growth. The results of soil cation enhancement by these bacteria showed that there were no major changes in measured parameters, such as total K, CEC, pH, and organic carbon. Furthermore, the variation in K exchange, organic carbon, and Na exchange provided insights into their unique interactions in the soil. The non-significant impact on potassium-related parameters in this study could be attributed to the presence of antagonistic cation interactions.
Genetic variation of the native Rusa deer (Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling M. HAFIZHUL IMAN; PARAMITA CAHYANINGRUM KUSWANDI; SENA ADI SUBRATA
Biodiversitas Journal of Biological Diversity Vol. 25 No. 1 (2024)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d250141

Abstract

Abstract. Iman MH, Kuswandi PC, Subrata SA. 2024. Genetic variation of the native Rusa deer (Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling. Biodiversitas 25: 355-360. Rusa deer is a vulnerable species with a large geographic range but natively inhabits Java and Bali. Despite the wide distribution, its native population is declining, raising a concern about a small population's adverse genetic effect. It encourages genetic studies to provide baseline data that has been vacant recently. This research aimed to demonstrate an application of non-invasive sampling to collect DNA samples and a simple procedure to obtain and analyze genetic data for the Rusa deer. This research also aimed to provide genetic variation of the native deer population as baseline data. The research sites were Baluran, Alas Purwo in East Java, and Bali Barat national parks from which fecal samples were collected. Moreover, 20 DNA samples were isolated from the feces using a kit (Dneasy PowerSoil Pro from Qiagen) and amplified at the control region gene using a forward: AAACCAGAAAAGGAGAGCAAC and a reverse: TCATCTAGGCATTTTCAGTGCC primer. The amplicons were sequenced, and the number of Haplotypes (Hn), Haplotype diversity (Hd), nucleotide diversity (p), site polymorphism, and phylogeographic tree were determined. The result showed that all the sequences had coverage of 100% and identity >98% with the Rusa timorensis sequence available in the GenBank. Furthermore, we found Hn = 11, Hd = 0.88, p = 0.005 and 30 site polymorphisms. Therefore, compared to an introduced population, the Rusa deer has a richer Hd and higher site polymorphism but a poorer p. Furthermore, we found that the Baluran population had high Hd, p, and is possibly forming a distinct clade.
Diversity of universal stress protein in Enterobacteriales and its reduced expressions on Pectobacterium brasiliense after manuka honey treatment CHOTIMAH CHOTIMAH; ALAN SOFFAN; TRI JOKO
Biodiversitas Journal of Biological Diversity Vol. 25 No. 1 (2024)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d250106

Abstract

Abstract. Chotimah, Soffan A, Joko T. 2024. Diversity of universal stress protein in Enterobacteriales and its reduced expressions on Pectobacterium brasiliense after manuka honey treatment. Biodiversitas 25: 49-52. Universal stress proteins (Usps) support the survival of an organism by increasing their expressions under stress conditions, which include nutritional deficiencies, heat shock, and antibiotics. However, the expression of uspA in Staphylococcus aureus decreased after manuka honey exposure. Manuka honey also inhibits the growth of Pectobacterium brasiliense, although its effect on the usp gene of this soft-rot pathogen has never been studied. This study aimed to determine the diversity of Usps in P. brasiliense and their orthologs from Enterobacteriales using phylogenetic analysis. The effects of manuka honey on usp gene expressions were also investigated using quantitative real-time polymerase chain reaction and pathogenicity assay of P. brasiliense on Chinese cabbage. The results revealed that the UspA, UspB, and UspE of P. brasiliense had the closest similarity to those of P. carotovorum. By contrast, UspG had the closest similarity to P. polaris. The usp gene expressions were downregulated by 5, 16, 10, and 62% in 5% (w/v) manuka honey treatment. When tested on Chinese cabbage, P. brasiliense treated with manuka honey caused smaller lesion symptoms than those in the control treatment. This reduced virulence of P. brasiliense may be related to the reduced expression of usp genes triggered by manuka honey.
Analysis of the difference in endophytic bacterial community structure between infected and non-infected rice plants with rice bakanae disease YANMIN YU; HAIYING LIU; ZHENHUA XU; PING YAN; HONGTAO WU; LICHENG WU
Biodiversitas Journal of Biological Diversity Vol. 25 No. 1 (2024)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d250122

Abstract

Abstract. Yu Y, Liu H, Xu Z, Yan P, Wu H, Wu L. 2024. Analysis of the difference in endophytic bacterial community structure between infected and non-infected rice plants with rice bakanae disease. Biodiversitas 25: 197-204. Rice bakanae disease, caused by the main pathogen Fusarium fujikuroi, is an important fungal disease that seriously threatens rice production. This study analyzed the effect of Fusarium fujikuroi on the community structure and diversity of endophytic bacteria in different rice tissues. The total DNA of different tissues, such as root, stem, and leaf, was extracted after artificial inoculation, and the bacterial 16SrRNA gene library was constructed. The high-throughput sequencing was used to analyze the biological information of bacterial community composition, diversity and function. The results showed that a total of 467841 effective sequences were obtained. Alpha diversity analysis showed that the diversity and richness of the endophytic bacterial community in infected plants were higher than in non-infected plants. At the phylum level, Cyanobacteria, Proteobacteria, Firmicutes, Acidobacteria, Bacteroidetes, Chloroflexi, and Actinobacteria were the dominant phyla. The infection of rice seedling bacteria causes changes in the abundance of endophytic bacteria in rice. Compared with non-infected plants, the abundance of Streptophyta and Acidovorax in the root decreased by 1.29 and 0.74%, respectively. The abundance of Geobacter, Devosia, Pleomorphomonas, and Herbaspirillum increased by 1.05, 1.55, 1.28, and 1.76%, while the abundance of Streptophyta in stem decreased by 7.83%. The abundance of Xanthomonas, Acidovorax, Pseudomonas and Sphingomonas increased by 1.55, 1.49, 1.11 and 1.15%, whereas the abundance of Streptophyta in the leaf decreased by 12.03%, Actinomycetales, Pseudomonas, Sphingomonas are significant biological differences between different tissues of infected and non-infected plants. The study provides a theoretical basis for the biological control of rice bakanae disease.
High-throughput analysis using 16S rRNA sequencing of bacterial communities associated in selected mangrove species from Bayug Island, Iligan City, Philippines STEFENIE KATRIN V. SIBLOS; SHARON ROSE TABUGO
Biodiversitas Journal of Biological Diversity Vol. 25 No. 1 (2024)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d250107

Abstract

Abstract. Siblos SKV, Tabugo SR. 2023. High-throughput analysis using 16S rRNA sequencing of bacterial communities associated in selected mangrove species from Bayug Island, Iligan City, Philippines. Biodiversitas 25: 53-61. Mangrove ecosystems are recognized globally as highly productive ecosystems, that play a crucial role in carbon sequestration, erosion control, water purification, and as essential breeding grounds for diverse aquatic life. They also offer specialized ecological niches, accommodating a diverse range of organisms, including bacterial communities. This study aimed to investigate bacterial communities of Bayug Island in Iligan City, Philippines, inhabiting six mangrove species, namely Rhizophora stylosa Griffith, Rhizophora apiculata Blume, Rhizophora mucronata Lam., Sonneratia alba Sm., Ceriops tagal (Perr.) C.B.Rob., and Nypa fruticans Wurmb and their possible functions within the mangrove forests. Genomic DNA was extracted from the six pooled soil samples, and the V3-V4 region of the 16S rRNA gene was sequenced using the Illumina MiSeq platform. Six amplicon libraries, corresponding to the mangrove species were analyzed with Parallel Meta Suite software, yielding 173,270 amplicon sequence variants (ASVs) after quality control. The study identified the top five most abundant ASVs in the mangrove rhizosphere, linked to the genera Vibrio, Stenotrophomonas, Serratia, Pseudoalteromonas, and Achromobacter. Among the mangrove species, S. alba exhibited higher alpha diversity according to the Shannon index. PICRUSt analysis revealed that microorganisms are involved in biodegradation, xenobiotic metabolism, and other metabolic processes within the mangroves. These bacteria could find applications in environmental cleanup, bioremediation, waste treatment, and soil health improvement. This result contributes to the ongoing ecological restoration of mangrove forests at the research site.

Page 1 of 5 | Total Record : 50

 1   2   3   4   5 

Filter by Year

2024 2024


Reset
Filter By Issues
All Issue Vol. 27 No. 9 (2026) Vol. 27 No. 8 (2026) Vol. 27 No. 7 (2026) Vol. 27 No. 6 (2026) Vol. 27 No. 5 (2026) Vol. 27 No. 4 (2026) Vol. 27 No. 3 (2026) Vol. 27 No. 2 (2026) Vol. 27 No. 1 (2026) Vol. 26 No. 12 (2025) Vol. 26 No. 11 (2025) Vol. 26 No. 10 (2025) Vol. 26 No. 9 (2025) Vol. 26 No. 8 (2025) Vol. 26 No. 7 (2025) Vol. 26 No. 6 (2025) Vol. 26 No. 5 (2025) Vol. 26 No. 4 (2025) Vol. 26 No. 3 (2025) Vol. 26 No. 2 (2025) Vol. 26 No. 1 (2025) Vol. 25 No. 12 (2024) Vol. 25 No. 11 (2024) Vol. 25 No. 10 (2024) Vol. 25 No. 9 (2024) Vol. 25 No. 8 (2024) Vol. 25 No. 7 (2024) Vol. 25 No. 6 (2024) Vol. 25 No. 5 (2024) Vol. 25 No. 4 (2024) Vol. 25 No. 3 (2024) Vol. 25 No. 2 (2024) Vol. 25 No. 1 (2024) Vol. 24 No. 12 (2023) Vol. 24 No. 11 (2023) Vol. 24 No. 10 (2023) Vol. 24 No. 9 (2023) Vol. 24 No. 8 (2023) Vol. 24 No. 7 (2023) Vol. 24 No. 6 (2023) Vol. 24 No. 5 (2023) Vol. 24 No. 4 (2023) Vol. 24 No. 3 (2023) Vol. 24 No. 2 (2023) Vol. 24 No. 1 (2023) Vol. 23 No. 12 (2022) Vol. 23 No. 11 (2022) Vol. 23 No. 10 (2022) Vol. 23 No. 9 (2022) Vol. 23 No. 8 (2022) Vol. 23 No. 7 (2022) Vol. 23 No. 6 (2022) Vol. 23 No. 5 (2022) Vol. 23 No. 4 (2022) Vol. 23 No. 3 (2022) Vol. 23 No. 2 (2022) Vol. 23 No. 1 (2022) Vol. 22 No. 12 (2021) Vol. 22 No. 11 (2021) Vol. 22 No. 10 (2021) Vol. 22 No. 9 (2021) Vol. 22 No. 8 (2021) Vol. 22 No. 7 (2021) Vol. 22 No. 6 (2021) Vol. 22 No. 5 (2021) Vol. 22 No. 4 (2021) Vol. 22 No. 3 (2021) Vol. 22 No. 2 (2021) Vol. 22 No. 1 (2021) Vol. 21 No. 12 (2020) Vol. 21 No. 11 (2020) Vol. 21 No. 10 (2020) Vol. 21 No. 9 (2020) Vol. 21 No. 8 (2020) Vol. 21 No. 7 (2020) Vol. 21 No. 6 (2020) Vol. 21 No. 5 (2020) Vol. 21 No. 4 (2020) Vol. 21 No. 3 (2020) Vol. 21 No. 2 (2020) Vol. 21 No. 1 (2020) Vol. 20 No. 12 (2019) Vol. 20 No. 11 (2019) Vol. 20 No. 10 (2019) Vol. 20 No. 9 (2019) Vol. 20 No. 8 (2019) Vol. 20 No. 7 (2019) Vol. 20 No. 6 (2019) Vol. 20 No. 5 (2019) Vol. 20 No. 4 (2019) Vol. 20 No. 3 (2019) Vol. 20 No. 2 (2019) Vol. 20 No. 1 (2019) Vol. 19 No. 6 (2018) Vol. 19 No. 5 (2018) Vol. 19 No. 4 (2018) Vol. 19 No. 3 (2018) Vol. 19 No. 2 (2018) Vol. 19 No. 1 (2018) Vol. 18 No. 4 (2017) Vol. 18 No. 3 (2017) Vol. 18 No. 2 (2017) Vol. 18 No. 1 (2017) Vol. 17 No. 2 (2016) Vol. 17 No. 1 (2016) Vol. 16 No. 2 (2015) Vol. 16 No. 1 (2015) Vol. 15 No. 2 (2014) Vol. 15 No. 1 (2014) Vol. 14 No. 2 (2013) Vol. 14 No. 1 (2013) Vol. 13 No. 4 (2012) Vol. 13 No. 3 (2012) Vol. 13 No. 2 (2012) Vol. 13 No. 1 (2012) Vol. 12 No. 4 (2011) Vol. 12 No. 3 (2011) Vol. 12 No. 2 (2011) Vol. 12 No. 1 (2011) Vol. 11 No. 4 (2010) Vol. 11 No. 3 (2010) Vol. 11 No. 2 (2010) Vol. 11 No. 1 (2010) Vol. 10 No. 4 (2009) Vol. 10 No. 3 (2009) Vol. 10 No. 2 (2009) Vol. 10 No. 1 (2009) Vol. 9 No. 4 (2008) Vol. 9 No. 3 (2008) Vol. 9 No. 2 (2008) Vol. 9 No. 1 (2008) Vol. 8 No. 4 (2007) Vol. 8 No. 3 (2007) Vol. 8 No. 2 (2007) Vol. 8 No. 1 (2007) Vol. 7 No. 4 (2006) Vol. 7 No. 3 (2006) Vol. 7 No. 2 (2006) Vol. 7 No. 1 (2006) Vol. 6 No. 4 (2005) Vol. 6 No. 3 (2005) Vol. 6 No. 2 (2005) Vol. 6 No. 1 (2005) Vol. 5 No. 2 (2004) Vol. 5 No. 1 (2004) Vol. 4 No. 2 (2003) Vol. 4 No. 1 (2003) Vol. 3 No. 2 (2002) Vol. 3 No. 1 (2002) Vol. 2 No. 2 (2001) Vol. 2 No. 1 (2001) Vol. 1 No. 2 (2000) Vol. 1 No. 1 (2000) More Issue