cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
Brigitta Laksmi Paramita
Contact Email
brigitta.laksmi@uajy.ac.id
Phone
+6282329549978
Journal Mail Official
journal.biota@gmail.com
Editorial Address
Fakultas Teknobiologi, Universitas Atma Jaya Yogyakarta, Jalan Babarsari No. 44, Sleman, Yogyakarta 55281, Indonesia
Location
Kota yogyakarta,
Daerah istimewa yogyakarta
INDONESIA
Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati
Published by Universitas Atma Jaya Yogyakarta
ISSN : 25273221     EISSN : 2527323X     DOI : doi.org/10.24002/biota
Core Subject : Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology
Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati merupakan jurnal ilmiah yang memuat hasil-hasil penelitian, kajian-kajian pustaka dan berita-berita terbaru tentang ilmu dan teknologi kehayatian (biologi, bioteknologi dan bidang ilmu yang terkait). Biota terbit pertama kali bulan Juli 1995 dengan ISSN 0853-8670. Biota terbit tiga nomor dalam satu tahun (Februari, Juni, dan Oktober).
Arjuna Subject : Ilmu Pertanian dan Biologi (Semua) - Ilmu Pertanian dan Biologi (Lain-Lain)
Articles 50 Documents
 1   2   3   4   5 
Search results for , issue "Vol 15, No 3 (2010): October 2010" : 50 Documents clear
Daya Dukung dan Laju Pertumbuhan Microcystis Hasil Isolasi dari Waduk Sutami pada Berbagai Variasi Konsentrasi Nitrat dan Fosfat dalam Medium Selektif B-12 Retnaningdyah, Catur; Suharjono, Suharjono; Soegianto, Agoes; Irawan, Bambang
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (408.522 KB) | DOI: 10.24002/biota.v15i3.2590

Abstract

The main objective of this research was to calculate the carrying capacity and growth rate ofisolated Microcystis result in Sutami reservoir on a variety of nitrate and phosphateconcentrations in the B-12 selective medium. Research was conducted in the laboratory withpure experiments using completely randomized factorial design with factors of nitrateconcentration variation (8, 16, 32, and 64 ppm) and phosphate (0.2, 0.4, 0.8 and 1.6 ppm) in B-12medium. Repetition of the study was conducted three times at the same time. Microcystispopulation abundance which was counted every day until the stationary phase (day +30) wasused to calculate the rate of growth (β) and maximum abundance of Microcystis can besupported by each medium treatment (γ). The results showed that the growth rate of Microcystiswas not significantly influenced by levels of phosphate in the medium but significantly positivelycorrelated with increasing nitrate concentration in the medium. Carrying capacity or themaximum abundance (γ) of Microcystis was influenced by the combination of nitrate andphosphate in the B12 medium. Concentration of phosphate 0.4 ppm in medium combined withnitrate 8−64 ppm could support the highest abundance of Microcystis.
Interpretasi Genetik Pola Pita Isozim pada Cherax quadricarinatus Hasil Budidaya di Purwokerto dan Bogor Bhagawati, Dian; Abulias, Muh. Nadjmi
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (238.391 KB) | DOI: 10.24002/biota.v15i3.2606

Abstract

A study on genetic interpretation of isozyme band patterns of C. quadricarinatus cultured in Purwokerto and Bogor showed the good visualization of aspartat transaminase, alkohol dehidrogenase, malat dehidrogenase, esterase and acid phosphatase. Twelve loci resulted low level of polymorphism (P= 0,25) and also low valve of heterozygosity (H= 0,09). It indicated that the genetic diversity of both populations was low.
Khelatisasi Ion Aluminium oleh Asam Organik Eksudat Akar Brachiaria Hafif, B.; Sabiham, S.; Iswandi, A.; Sutandi, A.; Suyamto, Suyamto
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (389.978 KB) | DOI: 10.24002/biota.v15i3.2585

Abstract

Aluminum toxicity is one of the major factors inhibiting plant growth in acid soils. Brachiaria grass adapt to high Al concentration. This experiment was conducted to study exudation of low molecular weight organic acids (LMWOA) activated by Al, from Brachiaria roots and its potential in chelating Al. Three Brachiaria species, i.e. B. decumbens, B. ruziziensis and B. brizantha, planted in sterile sand culture and were treated with 5 Al concentrations (0, 100, 200, 300 and 400 μM). After two-month experiment, three kinds of LMWOA, i.e, malic, citric, and oxalic acids, produced by the three Brachiaria-root exudates were measured in the sand culture. The production of malic acid was higher than that of citric and oxalic acid. Those organic acids were influenced by Al concentration; the higher Al concentration the higher organic acid content would be. The organic acids were also proved to form Al-organic compounds effectively of which B. decumbens and B. brizantha were more effective in chelating Al at relatively low Al (100 μM) and at relatively high Al concentration (300 μM and 400 μM), respectively.
Penggunaan Operkulum dalam Penentuan Umur pada Rhinoclavis sinensis Gmelin 1791 (Gastropoda: Cerithiidae) Zahida, Felicia; Subagja, Jusup
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (312.641 KB) | DOI: 10.24002/biota.v15i3.2601

Abstract

Age determination of the sample specimen is very important for population dynamic research of R. sinensis (Gastropoda : Cerithiidae). Operculum is a “hard” part stick on the dorsal portion of the foot of gastropods. Operculum appeared on the day of the snails are born and have their own specific shape, size, and materials composition. The aim of this research was to describe the use of operculum in age determination of R. sinensis. The method used in this research was: the operculums were soaked into saturated sodium hydroxide, washed and mounted them in Canada balsam, and observed using binocular microscope. Regression analysis was used to find the relationship between length of operculum to length of shell, and number of adventicious layers of operculum to length of shell. The research resulted that the length of operculum was comparable with the shell length, with the regression line of Y=0.113X +1.898 (R2=0.857). The growth of adventitious’ layers of the operculum coincided with the growth of the shell that in the second year, the growth of adventitious layers was two layers a year. At the age of three and four, the growth was one layer a year. During the fifth, sixth and seventh years, the growth was only a layer within three years. The regression line was Y=0.168X (R2=0.872).
Keanekaragaman Lumut di Kawasan Cagar Alam Dungus Iwul, Jasinga, Jawa Barat Windadri, Florentina Indah
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (289.579 KB) | DOI: 10.24002/biota.v15i3.2596

Abstract

Exploration and collection of the mosses species in Dungus Iwul Nature Reserve were conducted. Thirty eight species including 26 genera and 11 families were recorded. Three species had categories as endemic species i.e Fissidens teysmannianus and Orthomnion javense as endemic species in Java and Hyophila javensis as endemic species in Malesia. Ctenidium lychnites was recorded also as new species record in Java.
Kajian Molekuler Layu Buah Muda Kakao (Theobroma cacao L.): Ekspresi TcPIN1 Like Gene Astuti, Yohana Theresia; Dewi, Kumala; Santosa, Santosa; Prawoto, A. Adi
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (377.591 KB) | DOI: 10.24002/biota.v15i3.2591

Abstract

This experiment was carried out to evaluate the expression of TcPIN1 like gene in cocoa (Theobroma cacao L.). DNA and RNA were extracted from 7 weeks old of both healthy and cherelle wilt cocoa pods. PCR was done with two primer set based on PIN1 sequenced of Arabidopsis. Primer PIN1-1: Forward: taaggtgatgccaccaacaa; Reverse: gccatgaacaacccaagact. Primer PIN!-2: Forward: tttgtgtggagctcaagtgc; Reverse: ctgcgtcgttttgttgctta. RT-PCR was done with primer PIN1-2. The results showed that TcPIN1-2 like gene was found in healthy young pods, but not availabe in cherelle wilt pods of cocoa.
Khemotaksis Rhizobakteri Osmotoleran pada Rizosfer Tanaman Kacang Hijau (Vigna radiata, L.) Maryani, Yekti
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (484.314 KB) | DOI: 10.24002/biota.v15i3.2607

Abstract

This research has an objective to study chemotaxis of osmotolerant rhizobacteria strains Al-19 dan M7b in greenpea plant. These isolates were used to inoculate greenpea plant. The study on chemotaxis of osmotolerant rhizobacteria was conducted by CFU method in order to count the number of osmotolerant rhizobacteria AL-19 dan M7b in rhizosphere. Visualization of those isolates on root surface used fluorescence microscope and agglutination reaction with exudates of greenpea root. Result of the study showed that both isolates of osmotolerant rhizobacteria Al-19 dan M7b were found in rhizosphere of greenpea with low-density. Simple carbohydrate is substrat that is essential for rhizobacteria to grow thus the chemotaxis of both rhizobacteria is considered as metabolism - dependent. It means that it is not only as digested material but also function as affinity substance. These isolates gathered on the root surface weakly and did not make glutination reaction. This condition indicated that these isolates could not form colony on root surface of greenpea.
Keragaman Genetik Kultivar Pisang Diploid (AA) Koleksi Cibinong Science Center Berdasarkan Marka RAPD dan ISSR Poerba, Yuyu Suryasari; Ahmad, Fajarudin
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (471.587 KB) | DOI: 10.24002/biota.v15i3.2584

Abstract

The banana (Musa acuminata Colla) is considered as an important crop plant due to its high economic value which also has good dietary source. Here, the genetic variation of 20 diploid (AA) banana cultivars from Cibinong Science Center collection were analyzed. Random amplified polymorphic DNAs (RAPDs) and Inter Simple Sequence Repeats fingerprinting of these banana cultivars were carried out by four primers of RPDSs and two primers of inter simple sequence repeats (ISSRs) led to DNA amplification. The amplification products of RPADs and ISSRs were polymorphic, 97.83% and 95%, respectively. Size of the bands was varied from 350bp to 2.0 kbp. The range of genetic distance was from 0.06 to 0.07. The molecular data showed that these banana varieties were diverse collection.
Peran Ovicidal Herbal Serbuk Biji Pepaya (Carica papaya L) Matang Terhadap Telur Cacing Ascaris suum Ardana, Ida
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (313.292 KB) | DOI: 10.24002/biota.v15i3.2600

Abstract

An in vitro experiment to determine the effect of ground mature papaya seeds on characteristics of Ascaris suum eggs was conducted employing a Randomized Block Design. Four doses of the ground preparation – 0 mg (as control), 285 mg, 570 mg, and 855 mg- in 40 ml of physiological saline solution – were used to soak 100 eggs. Six replications were made. Worm eggs were obtained from the uteruses of ascariasis pigs slaughtered at the local abattoir. The eggs characteristics observed after application of the treatment were the embryo formation ability and the damage of egg cell layers. Statistical analysis was applied to the data collected using Analysis of Variance followed by Least Significance Test. The results showed that the ability of treated eggs to form embryos was significantly lower than that of control. Such a decrease in embryo formation ability could be related to the formation of granule (albumen coagulation) in the egg cell layers after the treatments. All treated eggs possessed such granules.
Struktur Komunitas Moluska Bentik di Perairan Sekitar PLTU Grati, Pasuruan, Jawa Timur Arbi, Ucu Yanu
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (507.729 KB) | DOI: 10.24002/biota.v15i3.2595

Abstract

Observation on marine benthic molluscs around PLTU Grati waters in Pasuruan was conducted on May and December 2004. The aim of this study was to determine condition and community structure of benthic molluscs living in those areas. Samples were collected using Eckmann grab and sieved through 0.5 mm mesh-sized. The number of molluscs species is 28 species, consisting of 16 species class of gastropoda and 12 species class of pelecypoda. A diversity index (H) ranged 0.845 to 1.158, an evenness index (J) was 0.856 to 1 and a richness index (D) was 19.562 to 31.949. Littorina undulata (Littorinidae) was a dominant species and was relatively widely distributed. In general, this result showed that around PLTU Grati waters had a relatively low benthic molluscs diversity.

Page 1 of 5 | Total Record : 50

 1   2   3   4   5 

Filter by Year

2010 2010


Reset
Filter By Issues
All Issue Vol 10, No 3 (2025): October 2025 Vol 10, No 2 (2025): June 2025 Vol 10, No 1 (2025): February 2025 Vol 9, No 3 (2024): October 2024 Vol 9, No 2 (2024): June 2024 Vol 9, No 1 (2024): February 2024 Vol 8, No 3 (2023): October 2023 Vol 8, No 2 (2023): June 2023 Vol 8, No 1 (2023): February 2023 Vol 7, No 3 (2022): October 2022 Vol 7, No 2 (2022): June 2022 Vol 7, No 1 (2022): February 2022 Vol 6, No 3 (2021): October 2021 Vol 6, No 2 (2021): June 2021 Vol 6, No 1 (2021): February 2021 Vol 5, No 3 (2020): October 2020 Vol 5, No 2 (2020): June 2020 Vol 5, No 1 (2020): February 2020 Vol 4, No 3 (2019): October 2019 Vol 4, No 2 (2019): June 2019 Vol 4, No 1 (2019): February 2019 Vol 4, No 1 (2019): February 2019 Vol 3, No 3 (2018): October 2018 Vol 3, No 2 (2018): June 2018 Vol 3, No 1 (2018): February 2018 Vol 3, No 1 (2018): February 2018 Vol 2, No 3 (2017): October 2017 Vol 2, No 2 (2017): June 2017 Vol 2, No 1 (2017): February 2017 Vol 2, No 1 (2017): February 2017 Vol 1, No 3 (2016): October 2016 Vol 1, No 2 (2016): June 2016 Vol 1, No 1 (2016): February 2016 Vol 1, No 1 (2016): February 2016 Vol 19, No 1 (2014): February 2014 Biota Volume 19 Nomor 1 Tahun 2014 Biota Volume 13 Nomor 2 Tahun 2014 Vol 18, No 2 (2013): June 2013 Vol 18, No 1 (2013): February 2013 Biota Volume 18 Nomor 1 Tahun 2013 Vol 17, No 3 (2012): October 2012 Vol 17, No 2 (2012): June 2012 Vol 17, No 1 (2012): February 2012 BIOTA Volume 17 Nomor 3 Tahun 2012 Vol 16, No 2 (2011): June 2011 Vol 16, No 2 (2011): June 2011 Vol 16, No 1 (2011): February 2011 Vol 16, No 1 (2011): February 2011 Vol 15, No 3 (2010): October 2010 Vol 15, No 2 (2010): June 2010 Vol 15, No 1 (2010): February 2010 Vol 14, No 3 (2009): October 2009 Vol 14, No 2 (2009): June 2009 Vol 14, No 1 (2009): February 2009 Vol 13, No 3 (2008): October 2008 Vol 13, No 2 (2008): June 2008 Vol 13, No 1 (2008): February 2008 Vol 12, No 3 (2007): October 2007 Vol 12, No 2 (2007): June 2007 Vol 12, No 1 (2007): February 2007 Vol 11, No 3 (2006): October 2006 Vol 11, No 2 (2006): June 2006 Vol 11, No 1 (2006): February 2006 Vol 10, No 3 (2005): October 2005 Vol 10, No 2 (2005): June 2005 Vol 10, No 1 (2005): February 2005 Vol 9, No 3 (2004): October 2004 Vol 9, No 2 (2004): June 2004 Vol 9, No 1 (2004): February 2004 Vol 8, No 3 (2003): October 2003 Vol 8, No 2 (2003): June 2003 Vol 8, No 1 (2003): February 2003 More Issue