Claim Missing Document
Check
Articles

Found 22 Documents
Search

PENGARUH BUDAYA SEKOLAH, PERSEPSI GURU TENTANG KEPEMIMPINAN KEPALA SEKOLAH, DAN MOTIVASI KERJA TERHADAP KINERJA GURU DI SD PRIME ONE SCHOOL MEDAN Dewi, Kumala
TABULARASA Vol 10, No 1 (2013): JURNAL TABULARASA
Publisher : TABULARASA

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Effects of Light Quality on Vegetative Growth and Flower Initiation in Phalaenopsis Dewi, Kumala; Purwestri, Yekti Asih; Astuti, Yohana Theresia Maria; Natasaputra, Lila; P, Parmi
Indonesian Journal of Biotechnology Vol 19, No 1 (2014)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (500.288 KB)

Abstract

The effects of LEDs (Light-Emitting Diodes) emitting different colours namely red, blue, red andblue, and white lights on vegetative growth and fl ower initiation of Phalaenopsis have been evaluated.Phalaenopsis“otohine/taisuco fi re bird” seedlings in vitro were subjected to different light qualities for either2 or 4 weeks, and then each seedling was planted in a plastic pot containing sphagnum and grown in thegrowth chamber under similar light quality for 3 months. For fl ower induction, mature Phalaenopsis plantshaving 4 – 6 leaves were grown for 3 months in the growth chamber under different light qualities. The leafspan, chlorophyll, gibberellin and cytokinin content were determined. In addition, the expressions of FT-likegene in the leaf, axillary bud, fl ower bud and stalk were examined.Vegetative growth was enhanced under blue, red-blue or white LEDs compared to that of the control.Gibberellin and cytokinin content increased in the seedlings subjected to white LEDs. Based on the averageof leaf span increment it was suggested that the growth of Phalaenopsis seedlings can be promoted by givingeither blue, red-blue or white LEDs. From the second experiment, it was found that fl ower induction inPhalaenopsis can be obtained in plants that had just fi nished fl owering without the application of LEDs. Theexpression of FT-like gene in the leaf as well as fl ower bud and stalk suggests that this gene is involved infl ower regulation of Phalaenopsis.
Expression analysis of antioxidant genes in response to drought stress in the fl ag leaf of two Indonesian rice cultivars R, Refli; Muljopawiro, Sukarti; Dewi, Kumala; Rachmawati, Diah
Indonesian Journal of Biotechnology Vol 19, No 1 (2014)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (279.254 KB)

Abstract

The objective of this study was to analysis the expression of antioxidant genes in response to droughtstress in Indonesian rice. The malondialdehyde (MDA) content and the expression of Cu-ZnSod1, cCu-ZnSod2,MnSod1, cApxa, cApxb, chl-sApx, Cat1, Cat2, Cat3, Gr1, Gr2, and Gr3 genes were assayed in the rice fl ag leaf ofCiherang and Situ Bagendit cultivars subjected to control, mild and severe drought during the grain fi llingphase. Increase in MDA content of Ciherang treated to mild and severe drought was almost two-fold andthree-fold respectively, while MDA content in Situ Bagendit subjected to mild and severe drought increasedapproximately one-fold and two-fold as compared to the control. The semi quantitative reverse transcriptionpolymerase chain reaction (sqRT-PCR) analysis showed that the expression of cCu-ZnSod1, MnSod1, Cat2, Gr3genes of Ciherang, and cCu-ZnSod2, MnSod1, cApxa, cApxb, chl-sAPX, Cat2 and Gr1 genes of Situ Bagendit increasedin fl ag leaf of plant treated to drought. Expressions of cApxb, chl-sApx, Cat3 of Ciherang and Cu-ZnSod1 and Gr2genes of Situ Bagendit were not changed signifi cantly by drought stress. Decreased expression was shownby cCu-ZnSod2, cApxa, Cat1, Gr1 and Gr2 genes of Ciherang, and Cat1, Cat3 and Gr3 genes of Situ Bagendit. Theresults indicated that the activity of oxidative defense was regulated by four genes; cCu-ZnSod1, MnSod1, Cat2,Gr3 in Ciherang, and eight genes; cCu-ZnSod1, cCu-ZnSod2, MnSod1, cApxa, cApxb, chl-sApx, Cat2 and Gr1 in SituBagendit. Therefore, differences in the number of antioxidant genes controlling oxidative defense systemmight determine the difference of the oxidative defense capacity between both cultivars in response to droughtstress during grain fi lling.
Flavonoid Production in Callus Cultures from Mesocarp of Stelechocarpus burahol Habibah, Noor Aini; Moeljopawiro, Sukarti; Dewi, Kumala; Indrianto, Ari
Biosaintifika: Journal of Biology & Biology Education Vol 8, No 2 (2016): September 2016
Publisher : Department of Biology, Faculty of Mathematics and Sciences, Semarang State University . Ro

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15294/biosaintifika.v8i2.6632

Abstract

Stelechocarpus burahol is one of the medicinal plants that contains flavonoids. The study was carried out to know flavonoid production of cultures in vitro S. burahol from mesocarp explants. Mesocarp explants were cultured on MS medium containing different combination and concentration of plant growth regulators i.e. picloram (5, 7.5 and 10 mg/L) and 2, 4-D (10, 15 and 20 mg/L) under dark condition. Induction of callus formation started on the 20.29th to the 29.86th days. Medium supplemented with Picloram and dark state proved to be the best condition for optimum callus induction from mesocarp explants of S. burahol. Callus grown on medium with the addition of 7.5 mg/l Picloram produces the highest flavonoid. The maximum production of the secondary metabolite was obtained from 8 weeks old callus. However, by the time of callus ageing, its output has declined. It could be concluded that callus cultures from mesocarp S. burahol can be used for flavonoid production.How to CiteHabibah, N. A., Moeljopawiro, S. Dewi, K. & Indrianto, A. (2016). Flavonoid Production in Callus Cultures from Mesocarp ofStelechocarpus burahol. Biosaintifika: Journal of Biology & Biology Education, 8(2), 214-221.
Growth Response of Sorghum bicolor (L.) Moench. Cultivars to Trivalent Chromium Stress Kasmiyati, Sri; Santosa, Santosa; Priyambada, Irfan Dwidja; Dewi, Kumala; Sucahyo, Sucahyo; Sandradewi, Rintawati
Biosaintifika: Journal of Biology & Biology Education Vol 8, No 1 (2016): March 2016
Publisher : Department of Biology, Faculty of Mathematics and Sciences, Semarang State University . Ro

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15294/biosaintifika.v8i1.5178

Abstract

One of heavy metal pollutants in the soil that can be absorbed by the sorghum is chromium (Cr). The study was conducted to determine the growth response of Cr3+ stress of sorghum cultivars. Two chemical compounds Cr3+ and 3 level concentrations were exposed to sorghum cultivars. The research was conducted in two separate experiments i.e. during seed germination and early seedling development stages. The parameters measured were radicle/root length, seedling length, fresh weight, dry weight, and stress tolerance index (STI) value. The results showed that Cr3+ either in form of CrCl3 or KCr(SO4)2 significantly reduced the seedling growth of sorghum cultivars. The growth responses of sorghum cultivars toward Cr3+ stress showed differences both on stage of the germination and early seedling. Based on the average of STI value, four sorghum cultivars (Badik, Keris, Keris M3 and Numbu) were classified as very strong tolerant, 4 cultivars (Hegari, Mandau, Sangkur and Gambela) were categorized as moderate tolerant, two cultivars (UPCA and Selayer) were weak tolerant, and 2 cultivars (Kawali and Batari) were sensitive ones, under stress condition of Cr3+.The results of this study are expected to provide the scientific basis of the physiological and tolerance responses of sorghum cultivars toward Cr3+ stress condition.How to CiteKasmiyati, S., Santosa, S., Priyambada, I., Dewi, K., Sucahyo, S., & Sandradewi, R. (2016). Growth Response of Sorghum bicolor (L.) Moench. Cultivars to Trivalent Chromium Stress. Biosaintifika: Journal of Biology & Biology Education, 8(1), 71-84.
Kajian Molekuler Layu Buah Muda Kakao (Theobroma cacao L.): Ekspresi TcPIN1 Like Gene Astuti, Yohana Theresia; Dewi, Kumala; Santosa, Santosa; Prawoto, A. Adi
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (377.591 KB) | DOI: 10.24002/biota.v15i3.2591

Abstract

This experiment was carried out to evaluate the expression of TcPIN1 like gene in cocoa (Theobroma cacao L.). DNA and RNA were extracted from 7 weeks old of both healthy and cherelle wilt cocoa pods. PCR was done with two primer set based on PIN1 sequenced of Arabidopsis. Primer PIN1-1: Forward: taaggtgatgccaccaacaa; Reverse: gccatgaacaacccaagact. Primer PIN!-2: Forward: tttgtgtggagctcaagtgc; Reverse: ctgcgtcgttttgttgctta. RT-PCR was done with primer PIN1-2. The results showed that TcPIN1-2 like gene was found in healthy young pods, but not availabe in cherelle wilt pods of cocoa.
Allelopathic Effect of Cyperus rotundus L. on Seed Germination and Initial Growth of Glycine max L. cv. Grobogan Darmanti, Sri; Santosa, Santosa; Dewi, Kumala; Nugroho, L Hartanto
Bioma : Berkala Ilmiah Biologi Vol. 17, No.2, Tahun 2015
Publisher : Departemen Biologi, Fakultas Sains dan Matematika, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (295.657 KB) | DOI: 10.14710/bioma.17.2.61-67

Abstract

Allelopathy is a phenomenon of direct or indirect, beneficial or adverse effects of a plant on its own or another plant through the release of chemicals into the environment. This experiment was carried out to determine the allelopathic effect of Cyperus rotundus L. (purple nutsedge) tuber aqueous extract on seed germination and initial growth of Glycine max L. (soybean) seedlings. The experiment was performed in completely randomized (CRD) design with five replications, using a range of concentrations of aqueous tuber extracts of nutsedge, i.e.: 0%, 5%, 10%, 15%, 20% and 25%. The petri dish experiment showed that with increase of the tuber extract concentration, a significant increase was noted in mean germination time (MGT), significant decreases in germination index (GI), growth tolerance index (GTI), wet weight seedling, dry weight seedling and  length of soybean seedling.  
Perkecambahan Biji Dan Pertumbuhan Kecambah Varietas Sorgum (Sorghum bicolor L.) Pada Cekaman Krom Heksavalen Kasmiyati, Sri; S, Santosa; Priyambada, Irfan Dwidja; Dewi, Kumala; Sandradewi, Rintawati
Bioma : Berkala Ilmiah Biologi Vol. 17, No.1, Tahun 2015
Publisher : Departemen Biologi, Fakultas Sains dan Matematika, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (279.742 KB) | DOI: 10.14710/bioma.17.1.41-54

Abstract

In contrast to other toxic trace metals, Cr has received little attention. Since valence level of chromium determines its toxicity, chromium is categorized as unique heavy metal. Chromium hexavalent (Cr6+) has the biggest toxicity among other valence levels. Seed germination and seedling growth are sensitive to heavy metal stresses. This research aimed to find out the responses of seed germination and seedling growth of 12 sorghum varieties toward Cr6+. Seed germination and seedling growth experiment was done on 12 sorghum varieties (Badik, UPCA-1, Keris, Keris M3, hegari Genjah, Gambela, Selayer, Sangkur, Mandau, Batari, Kawali, dan Numbu), planted in petridishes with Cr6+ treatment in form of chromate (K2CrO4) and dichromate (K2Cr2O7) compounds with 0, 50 and 500 mg of Cr/l concentration for a week. The parameters measured were the number of seeds germinate each day; the length of radicle and plumule, and fresh and dry weight at the end of experiment. The results showed that higher concentration of Cr6+ both in form of dichromate and chromate, significantly decreased  the length of radicle and plumule, fresh and dry weight, and SVI (seedling vigor index) value. However, index germination (GI) value and percentage of germination of the 12 varieties sorgum significantly increased in the treatment of 50 mg Cr/l Cr6+ in form of dichromate and chromate. The treatment of dichromate compound showed bigger effect than chromate toward variables of seed germination and seedling growth of sorghum. It was noticed that 12 sorghum varieties possessed an integrated complex of adaptation to cope with the range of form of compound and concentration of Cr6+. Based on the responses of seed germination and seedling growth, Kawali, Hegari, Keris, Keris M3, Mandau, and Selayer varieties was more susceptible toward Cr6+ toxicity, and Sangkur, Selayer, Batari, and Numbu was more tolerant than other varieties. Keywords : chromate, dichromate, Sorghum bicolor, seedling, hexavalent chromium
Kinetika Pertumbuhan Dan Produksi Inulinase Fusan F7 Wijanarka, Wijanarka; Soetarto, Endang Sutariningsih; Dewi, Kumala; Indrianto, Ari
Bioma : Berkala Ilmiah Biologi Vol. 15, No.2, Tahun 2013
Publisher : Departemen Biologi, Fakultas Sains dan Matematika, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (74.963 KB) | DOI: 10.14710/bioma.15.2.53-57

Abstract

Pertumbuhan dapat diartikan sebagai suatu pertambahan bagian-bagian sel. Adanya     pertumbuhan sel biasanya dapat diketahui dengan adanya pertambahan ukuran dan     pembelahan sel. Populasi sel khususnya mikroba  secara kuantitatif atau kualitatif dapat digunakan untuk memantau atau mengkaji fenomena pertumbuhan.Enzim inulinase (E.C. 3.2.1.7) adalah enzim yang mampu merombak substrat inulin menjadi monomer fruktosa. Fruktosa merupakan bahan baku (doctoring agent) untuk proses  pembuatan FOS, IOS, pulullan, aseton dan sorbitol.Tujuan  penelitian ini adalah untuk mengetahui kinetika kecepatan pertumbuhan specifik (µ), waktu generasi (g) dan aktivitas inulinase yang dihasilkan oleh fusan F7.  Fusan F7 merupakan hasil fusi antara Pichia manshurica dan Rhodosporidium paludigenum.Hasil penelitian menunjukkan bahwa Fusan F7 mempunyai kecepatan pertumbuhan specific (µ)  sebesar 0.3299 jam dengan waktu generasi (g) 2.1012 jam dan aktivitas enzim inulinase yang dihasilkan sebesar  0.5337 IU. Hasil tersebut  terletak diantara kedua parentalnya yaitu P. manshurica (µ= 0.27935 jam; g = 2.4815 jam dan aktivitas = 0.557 IU) dan Rh. paludigenum (µ= 0.3787 jam; g = 1.8304 jam dan aktivitas = 0.3263 IU). Kata kunci : Pertumbuhan;  fusan F7; inulinase ; umbi dahlia
Kemampuan Fusan F1 Dalam Memproduksi Inulinase Wijanarka, Wijanarka; Soetarto, Endang Sutariningsih; Dewi, Kumala; Indrianto, Ari
Bioma : Berkala Ilmiah Biologi Vol. 16, No.2, Tahun 2014
Publisher : Departemen Biologi, Fakultas Sains dan Matematika, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (75.57 KB) | DOI: 10.14710/bioma.16.2.114-118

Abstract

Fusan F1 was the result of the fusion of the Pichia manshurica and Rhodosporidium paludigenum. The second type of yeast has the ability to produce inulinase.  Inulinase (EC. 3.2.1.7) is an enzyme that is classified as a hydrolase enzyme, this enzyme has the ability to break down complex inulin into simpler components that fructose. Fructose was a monosaccharide with huge potential for the manufacture of butanol, iOS, pullan, FOS and ethanol. The purpose of research to determine the ability fusan F1 in producing inulinase and to determine the specific growth rate (μ), as well as the generation time (g) fusan F1.The results showed that fusan F1 at the 18 thhour was able to produce inulinase of 0.61 mol / min. These results are higher than the parental namely P. manshurica (0.56 mol / min) and Rh. paludigenum (0.33 mol / min). While The specific growth rate (μ) and generation time (g) fusan F1 respecly 0.25 h and 2.7/ h. Keywords: Fusan F1; inulinase; the specific growth; generation time