cover
Contact Name
Muhammad Syahrir
Contact Email
m.syahrir7406@unm.ac.id
Phone
-
Journal Mail Official
nurkhasanah@pharm.uad.ac.id
Editorial Address
Jl. Prof. Dr. Soepomo, S.H., Janturan, Warungboto, Umbulharjo, Yogyakarta, Indonesia Kode pos 55164
Location
Kota yogyakarta,
Daerah istimewa yogyakarta
INDONESIA
Pharmaciana: Jurnal Kefarmasian
ISSN : 20884559     EISSN : 24770256     DOI : 10.12928
Core Subject : Health,
Pharmaciana is a scientific journal published by the University of Ahmad Dahlan worked closely with Ikatan Apoteker Indonesia (IAI). Pharmaciana published three times a year, namely March, July and November. with ISSN 2088-4559 and e-ISSN 2477-0256. The article published in the Journal Pharmaciana selected by editors and reviewed by the reviewer. Articles published in Pharmaciana must not be published in other journals or have been previously published. Pharmaciana is indexed in google scholar, ACI (Asean Citation Index), Dimension (Crossreff), Garuda, Sinta, Sherpa Romeo, Index Copernicus International, DOAJ, and BASE. Pharmaciana is accredited by DIKTI (DGHE) of Indonesia No. 105/E/KPT/2022 April 07, 2022
Articles 14 Documents
Search results for , issue "Vol 9, No 2 (2019): Pharmaciana" : 14 Documents clear
Formulation of functional beverages from the combination of lime, tomato, and carrot using foam-mat drying method Kartini Kartini; Alfian Hendra Krisnawan; Lisa Calista Silvanus; Tiffanny Putri Wijaya
Pharmaciana Vol 9, No 2 (2019): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (385.886 KB) | DOI: 10.12928/pharmaciana.v9i2.14134

Abstract

 Lime, tomato, and carrot are natural ingredients widely used both as food and herbal medicines particularly because these plants contain various antioxidant compounds such as vitamin C, phenolics, flavonoids, and carotenoids. Since these materials are easily damaged when exposed to high temperatures, any processing methods that involve slight quality changes in the final product are favorable. This study aimed to formulate lime, tomato, and carrot into functional beverages using foam-mat drying method. Lime juice combined with either tomato paste or carrot juice was mixed with egg white and methylcellulose as foaming agents, then whipped using a mixer for 10 minutes to form a stable foam. The foam was placed in a stainless tray, flattened, and dried in an oven at 60°C for 5 hours. Once dried, the mass was scraped using a spatula, and the resultant dry powder was then evaluated for its physical characteristics and antioxidant activities using nitrite oxide (NO) method. The produced dry mass of lime, lime-tomato (1:1), and lime-carrot (1:1) had organoleptic characteristics, water content, sugar content, and food additives content in accordance with the Indonesian National Standard (SNI). Also, with the IC50 values of 4248, 4931, and 4218 µg/ml, the lime juice and its combination with tomatoes (1:1) and carrots (1:1) can be formulated into functional powder drinks that comply with the SNI quality requirements. Lime-carrot is a better combination than lime-tomato.
Effect of different preparation techniques of red dragon fruit (Hylocereus polyrhizus) extracts on normal human fibroblast viability Novi Febrianti; Triana Hertiani; Sukarti Moeljopawiro; Sofia Mubarika Haryana
Pharmaciana Vol 9, No 2 (2019): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (324.081 KB) | DOI: 10.12928/pharmaciana.v9i2.13054

Abstract

Red dragon fruit is one of the popular fruits that have been widely used both for consumption and food coloring. The red dragon fruit peel and flesh contain various antioxidant compounds that can be used as pharmaceutics and nutraceuticals. The objective of this study was to determine the effect of various extract preparations of the peel and the flesh of red dragon fruit on the viability of normal human fibroblasts. Seven conditions of peel and flesh extracts were prepared as follows, i.e. dried peel ethanolic extract, fresh blended peel ethanolic extract, dried flesh, fresh blended flesh ethanolic extract, blended fresh flesh, filtrate of pressed flesh, and pomace of pressed flesh. Each sample preparation was tested for its effect on the viability of normal human fibroblasts using MTT assay. Results showed that dried peel ethanolic extract reduce cell viability. Red dragon fruit flesh extracts caused no significant effect on the fibroblast viability. In conclusion, the fruit flesh extracts are relatively safer to normal cells than the peel extracts. IC50 value of the ethanolic extract of dried peel  was 55.38±3.85 µg/mL, while the IC50 value of various types of flesh extract were more than 500 µg/mL.
Standardization of durian fruit peels (Durio zibethinus Murr.) extract and antioxidant activity using DPPH method Muhtadi Muhtadi; Utami Ningrum
Pharmaciana Vol 9, No 2 (2019): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (317.736 KB) | DOI: 10.12928/pharmaciana.v9i2.12652

Abstract

Durian fruit peels (Durio zibethinus Murr.) has been studied previously and reported to have pharmacological activity that has the potential to be antioxidant and antihypercholesterol. The ethanolic extracts of Durian fruit peels contained secondary metabolites, namely flavonoids, polyphenols, carotenes, and saponins. The purpose of this study to determine the non-specific parameters and specific parameters of the ethanol extract of durian fruit peels and to evaluate the antioxidant activity with the DPPH method. Standardization of herbal ingredients is an important thing to do so that the safety and quality of herbal medicines can be maintained. Two different cultivars of durian fruit peels are used, there are Medan and Monthong. The results of non-specific parameters between Medan and Monthong cultivars showed different moisture content  (9.71 ± 0.96; 12.06 ± 0.34%, respectively), ash values (1.03 ± 0.20; 1.78 ± 0.07%, respectively), and water content (6.12 ± 0.29; 7.16 ± 0.25% respectively). Medan and Monthong cultivar extracts showed specific parameters showed different organoleptic information such as odor, color, and physical appearance, the content of water soluble compounds (36.39 ± 1.90%), the value of ethanol soluble compounds (40.20 ± 0.19; 45.27 ± 1.02%, respectively), and flavonoid value (472 ± 49.00; 310 ± 13.45 mg/g sample), phenolic value (245 ± 5.15; 148 ± 8.54 mg/g sample). Antioxidant activity was indicated by IC50 values of each extract, namely Medan  of 78.83 ± 1.67 µg/mL and Monthong of 72.77 ± 6.60 µg/mL. Statistical tests showed the value of non-specific parameters and specific parameters of the two cultivars not differed significantly. 
Real-Time PCR-based detection of bovine DNA by specific targeting on cytochrome-B Nina Salamah; Yuny Erwanto; Sudibyo Martono; Abdul Rohman
Pharmaciana Vol 9, No 2 (2019): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (6376.296 KB) | DOI: 10.12928/pharmaciana.v9i2.14070

Abstract

The design of specific primers is an interesting research topic such that it offers selective, specific, and effective DNA analysis using real-time PCR. This research was intended to detect bovine DNA using real-time PCR and specific primers to ensure the halal authenticity of food products. Primers of bovine DNA sequences were designed in the NCBI and Primer-BLAST programs. The outcome validation was assessed using several parameters, namely specificity, repeatability, and linearity by real-time PCR. Primer specificity test was performed on fresh tissue (pork and negative control), while the repeatability test used six replications and was based on the calculated coefficient of variation (CV). In the linearity test, six different DNA concentrations (50000, 10000, 5000, 500, 100, and 50 pg/µL) were examined to obtain the efficiency value. Using the specific primer from Cytochrome-B, the real-time PCR could specifically identify the presence of bovine DNA at the optimum annealing temperature of 58.70C. The  repeatability  analysis yielded a coefficient of variation (CV) of 0.57 %, while the linearity test produced an efficiency  value of  206 %. These figures confirm that the method employed  in this study is not only specific but also sensitive and reliable for detecting bovine DNA. Real-time PCR using specific primer targeting on the cytochrome-B region of bovine DNA (forward: CTACTGACACTCACATGAATTGG; reverse CACTAGGATGAGGAGAAAGTATAGG) can be used to identify bovine DNA and distinguish it from porcine DNA.
Effect of sugar cane molasses and tofu waste on the inhibitory activity of cell free fermentation broth of streptomyces antibioticus K-6 Astrid Aulia Hamida; Noor Erma Nasution; Isnaeni Isnaeni
Pharmaciana Vol 9, No 2 (2019): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (388.164 KB) | DOI: 10.12928/pharmaciana.v9i2.13808

Abstract

The use of waste as source of nutrition for human, animals, plants, and microorganism has been reported. The aim of this study was to observe the influence of sugar cane molasses (SCM) and tofu waste (TW) in various concentrations on the inhibitory effect of cell free fermentation broth (CFFB) of Streptomyces antibioticus K-6 isolated from plantation  soil compare  to International Streptomyces Project (ISP) standard  media. The fermentation was performed in 150 rpm rotary shaker at 37ºC for five days. The  inhibitory activity was  investigated using diffusion agar on the nutrient agar media to determine ratio of  SCM and TW by which the largest growth inhibitory zone achieved. Escherichia coli ATCC 25922 was used as a test microorganism. 10% of Streptomyces antibioticus K-6 starter was inoculated into nine compositions  of  SCM, TW and its combination containing media. The result indicated that SCM and TWmight be used as the component of fermentation medium of Streptomyces antibioticus K-6 for producing active metabolites. The activity of  CFFB was exhibited as a diameter of growth  inhibitory  zone  against the  test  bacteria; in which the largest value (24.4 mm) was detected in the combination of 0.5% SCM and 0.5% TW containig medium after  two days  incubation.
Formulation of orodispersible atenolol-β-cyclodextrin tablets with co-processed crospovidone-croscarmellose sodium and poloxamer 188 Karina Citra Rani; Nani Parfati; Linda Yosanti; I Gusti Ayu Yulivia Rosa Indah
Pharmaciana Vol 9, No 2 (2019): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (709.66 KB) | DOI: 10.12928/pharmaciana.v9i2.12841

Abstract

The use of conventional tablets in geriatric patients is currently limited because of a decrease in their physiological functions, such as tremor and difficulty of swallowing pills, which lowers their compliance with drug therapy. Hypertension, one of the degenerative diseases suffered by geriatric patients, is treatable with atenolol tablets or capsules that are less soluble in water or, in other words, has a poor dissolution. This research attempted to improve the dissolution of atenolol by formulating it into orodispersible tablets (ODTs), and as such, the disintegration time was modified by adding co-processed crospovidone-croscarmellose sodium in 1:1 ratio. Moreover, Poloxamer® 188 was added to the formulation of atenolol-β-cyclodextrin inclusion complex. The post-compression test revealed that ODTs disintegrated quickly within 36.67±1.21 seconds (<60 seconds) and had physical characteristics that met the pharmaceutical requirements. The amount of atenolol dissolved within 30 minutes in the dissolution study was 84.39% (%Q30 minutes). The results of the accelerated stability study (at 40 °C and RH 75±5 %) for two weeks proved that the physical and chemical characteristics of the produced orodispersible atenolol tablets were stable.
Anti-inflammatory effects of avocado peels against inflammation induced by carrageenan in mice Eko Aprilianto; Alexander Vito Harmoni Swantika Yuan; Claudia Darantika Pradita; Phebe Hendra
Pharmaciana Vol 9, No 2 (2019): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (397.479 KB) | DOI: 10.12928/pharmaciana.v9i2.13607

Abstract

The aim of this research is to investigate the anti-inflammatory activity of avocado peel against carrageenan-induced inflammation in mice. The group of mice that was used as a negative control group to test the anti-inflammatory activity of infusion and decoction (group I) were given aquadest, while the group for testing the activity of extract (group II) was given CMC-Na. The positive control group (group III) was given potassium diclofenac. Groups IV-VI were given avocado peel infusion with the following doses 667.5; 1335; and 2670 mg/kgBW respectively. Groups VII-IX were given avocado peel decoction with the same doses as the previous groups. Groups X-XII were given 830; 1670; and 3330 mg/kgBW of avocado peel extract respectively. The paw edema were measured using a digital caliper for 6 hours afterwards after carrageenan injection. There were a significant (p<0.05) reduction in paw edema at all doses of infusion, decoction, and extract of avocado peel. Based on the research, it can be concluded that the avocado peels have anti-inflammatory activities.
In vitro immunomodulatory activity test of Bengle rhizoma extract (Zingiber cassumunar Roxb.): phagocytic activity of macrophages and lymphocyte proliferation in mice Ghina Adhila; Nurkhasanah Nurkhasanah; Nanik Sulistyani
Pharmaciana Vol 9, No 2 (2019): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (282.609 KB) | DOI: 10.12928/pharmaciana.v9i2.12881

Abstract

Immunomodulators are pharmacological agents that affect the immune system at different levels. Aside from modulating, some immunomodulators stimulate, while some others inhibit immune responses. Zingiber cassumunar Roxb. or Bengle rhizoma has been reported to exhibit immunomodulatory activities. This research was intended to determine the pharmacological effects of its extract on the phagocytic activity  of  macrophages and lymphocyte proliferation in vitro. It used the macrophages and lymphocytes of male BALB/c mice, which were divided into normal control and treatment group (receiving 25, 50, and 100 ppm of extract). The immunomodulatory activity test results showed that 100 ppm of Bengle rhizoma extract reduced phagocytosis in macrophages much significantly than the control group and that the treatment groups suppressed the proliferation of lymphocytes more  substantially than the control group. The extract decreased the phagocytic activity of macrophages and the proliferation capacity of lymphocytes when administered at a concentration of 100 ppm.
The effects of dosage variation in black seed cumin oil (Nigella sativa L.) use on HbA1c levels and interleukin-17A expression in patients at risks of metabolic syndrome Vitri Agustiarini; Endang Darmawan; Akrom Akrom
Pharmaciana Vol 9, No 2 (2019): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (286.285 KB) | DOI: 10.12928/pharmaciana.v9i2.8055

Abstract

Metabolic syndrome causes an imbalance of the immune system and increased levels of HbA1c and IL-17A expression. Black cumin seed oil (BCSO) is known to have antioxidant and immunomodulatory  properties. This study reports the effects of dosage variation in BCSO (1.5 and 3 ml per day for 20 days) on HbA1c levels and IL-17A expression in patients at risk of metabolic syndrome at Jetis 1 Public Health Center in Bantul, Yogyakarta. It employed a crossover design in which a total of 66 patients at risk of metabolic syndrome were divided into two groups receiving a sequence of different treatments. Group 1 (N=33) received treatment A first, which was BCSO at a dose of 1.5 ml/day for 20 days. Then, after a washout period of 7 days, it received treatment B, 3 ml of BCSO per day for 20 days. Group 2 followed the same procedure only vice versa, treatment B, then A. The HbA1c levels were measured by the mean plasma glucose (MPG) method, while the IL-17A expression was detected by flow cytometry. The average HbA1c level and IL-17A expression of the treatment groups were statistically analyzed with 95% confidence level. In response to the treatment regime, the HbA1c level of group 1 was 7.34 ± 2.51% (a decrease), and that of group 2 was 7.72 ± 2.44% (an increase). The IL-17 expression in group 1 was 3.74 ± 3.52% (a decrease), and the one in group 2 was 4.07 ± 3.65% (an increase). The effects of administering 1.5 ml and 3 ml BCSO per day for 20 consecutive days on Hb1c level (p=0.17) and IL-17A expression (p=0.67) were not significantly different. Most patients experience a decrease in HbA1c levels and IL-17A expression after the treatment. Insignificant differences between the two groups mean that at the doses of 1.5 ml/day and 3 ml/day for 20 days, BCSO exhibits the same effects in patients at risk of metabolic syndrome registered at Jetis 1 Public Health Center in Bantul, Yogyakarta.
Exercise and consumption of herbal remedies decrease the risk of strokes in hypertension and diabetes mellitus patients undergoing a standard therapy Akrom Akrom; Melisa Rizki
Pharmaciana Vol 9, No 2 (2019): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (367.857 KB) | DOI: 10.12928/pharmaciana.v9i2.13143

Abstract

Stroke is a serious problem faced worldwide. It can result in death, physical disability, and mental disability. Hypertension and Diabetes Mellitus (DM) patients are high-risk populations. The study attempted to determine the factors associated with the incidence of stroke in DM or hypertension outpatients. This analytic observational study used a case-control design and nonrandom sampling technique with consecutive sampling approach. With a 1:2 ratio, the subjects consisted of 49 stroke patients in the case group and 98 non-stroke patients (hypertensive) for the control group. Subjects were patients undergoing treatments at PKU Muhammadiyah Hospital in Bantul. Patient's lifestyle data were collected through face-to-face interviews with patients, while demographic information, diagnosis, and patient history were obtained from medical records using data retrieval forms (case record forms). The variable age was matched with sex to improve the efficiency and accuracy of the study. Data analysis included univariate (descriptive) analysis and bivariate analysis using the Chi-Square test. Factors associated with stroke incidence were smoking habit (OR = 2.940, CI: 1.314 <OR <6.576; P = 0.007), exercise routine (OR = 0.026, CI: 0.008 <OR <0.079, P = 0.000), high-fat food dietary pattern (OR = 3.629, CI: 1.119 <OR <11.766; P = 0.024), and the habit of consuming herbal remedies (OR = 0.299, CI: 0.107 <OR <0.833; P = 0.016).  For hypertension or DM patients who took standard therapy at PKU Muhammadiyah Hospital in Bantul, smoking and fatty food consumption increased the risk of stroke, whereas physical exercise and herbs consumption habits reduced it.

Page 1 of 2 | Total Record : 14


Filter by Year

2019 2019


Filter By Issues
All Issue Vol. 15 No. 3 (2025): Pharmaciana Vol. 15 No. 2 (2025): Pharmaciana Vol. 15 No. 1 (2025): Pharmaciana Vol. 14 No. 3 (2024): Pharmaciana Vol. 14 No. 2 (2024): Pharmaciana Vol 14, No 1 (2024): Pharmaciana Vol. 14 No. 1 (2024): Pharmaciana Vol 13, No 3 (2023): Pharmaciana Vol. 13 No. 3 (2023): Pharmaciana Vol 13, No 2 (2023): Pharmaciana Vol 13, No 1 (2023): Pharmaciana Vol 12, No 3 (2022): Pharmaciana Vol 12, No 2 (2022): Pharmaciana Vol 12, No 1 (2022): Pharmaciana Vol 11, No 3 (2021): Pharmaciana Vol 11, No 2 (2021): Pharmaciana Vol 11, No 1 (2021): Pharmaciana Vol 10, No 3 (2020): Pharmaciana Vol 10, No 2 (2020): Pharmaciana Vol 10, No 1 (2020): Pharmaciana Vol 9, No 2 (2019): Pharmaciana Vol 9, No 1 (2019): Pharmaciana Vol 8, No 2 (2018): Pharmaciana Vol. 8 No. 2 (2018): Pharmaciana Vol 8, No 2 (2018): Pharmaciana Vol 8, No 1 (2018): Pharmaciana Vol 8, No 1 (2018): Pharmaciana Vol 7, No 2 (2017): Pharmaciana Vol 7, No 2 (2017): Pharmaciana Vol 7, No 1 (2017): Pharmaciana Vol 7, No 1 (2017): Pharmaciana Vol 6, No 2 (2016): Pharmaciana Vol 6, No 2 (2016): Pharmaciana Vol 6, No 1 (2016): Pharmaciana Vol 6, No 1 (2016): Pharmaciana Vol 5, No 1 (2015): Pharmaciana Vol 5 No 1, 2015 Vol 5, No 2 (2015): Pharmaciana Vol 5, No 2 (2015): Pharmaciana Vol 5, No 1 (2015): Pharmaciana Vol 5, No 1 (2015): Pharmaciana Vol 4, No 2 (2014): Pharmaciana Vol 4, No 2 (2014): Pharmaciana Vol. 4 No. 2 (2014): Pharmaciana Vol 4, No 1 (2014): Pharmaciana Vol 4, No 1 (2014): Pharmaciana Vol 3, No 2 (2013): Pharmaciana Vol 3, No 2 (2013): Pharmaciana Vol 3, No 1: Mei 2013 Vol 3, No 1 (2013): Pharmaciana Vol 3, No 1 (2013): Pharmaciana Vol 2, No 2 (2012): Pharmaciana Vol 2, No 2: November 2012 Vol 2, No 2 (2012): Pharmaciana Vol 2, No 1: Mei 2012 Vol 2, No 1 (2012): Pharmaciana Vol 2, No 1 (2012): Pharmaciana Vol 1, No 2: November 2011 Vol 1, No 2 (2011): Pharmaciana Vol 1, No 2 (2011): Pharmaciana Vol 1, No 1 (2011): Pharmaciana Vol 1, No 1: Mei 2011 Vol 1, No 1 (2011): Pharmaciana More Issue