Article Per Year (5 Year)
p-Index From 2021 - 2026
0
P-Index
This Author published in this journals
All Journal PROSIDING SEMINAR NASIONAL JURNAL LITBANG JURNAL KESEHATAN Squalen Bulletin of Marine and Fisheries Postharvest and Biotechnology Jurnal Biomedika Prosiding Seminar Nasional Unimus
Sri Sinto Dewi
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Humanities Biochemistry, Genetics & Molecular Biology Education Engineering Environmental Science Health Professions Immunology & microbiology Medicine & Pharmacology Nursing Public Health

Published : 16 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 16 Documents
Search

 1   2 
DAYA HAMBAT SAMPO ANTI KETOMBE TERHADAP PERTUMBUHAN C. albicans PENYEBAB KETOMBE Ariyani . .; Sri Sinto Dewi; Ratih . Haribi
JURNAL KESEHATAN Vol 2, No 2 (2009): Ilmu-Ilmu Kesehatan
Publisher : JURNAL KESEHATAN

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (395.734 KB)

Abstract

Abstract Anti-dandruff shampoos on the market are expected to inhibit the growth of Candida sp. on the Scalp, but the fact is not able to inhibit the growth of fungi that still occur as a manifestation of dandruff growth of Candida sp. The purpose of this study was to determine the growth of Candida sp. in media containing anti-dandruff shampoo. Types of research conducted experiments conducted in FIKKES UNIMUS Microbiology Laboratory. When the study in March and April 2006. Sample of pure cultures of Candida sp. Isolate BLK Semarang, and anti-dandruff shampoo containing active substances with Zn Pt O brand A, B, and C. Series of test done including manufacturing test solution consisting of shampoo solution with a concentration of 90%, 80%, 70%, 60%, 50%, suspicion Candida sp. contact time l, 2, 3, 4, and 5 minutes. Suspension Candida sp. Treated with test solution and planted in the medic and then incubated SGA 2x24 hours at a temperature of 370 C. Research results showed growth of Candida sp happen. on SGA medium (Glucose Saboroud order) which has been in contact with anti-dandruff shampoos A, B, and C at concentrations of 90%, with the Relative number of colonies decreased from the previous contact time of l, 2, 3, 4, and  5 minute. Of the three shampoos that can inhibit the growth of the fungus Candida sp. well is shampoo C. Conclusion that the higher konsetrasi shampoo and more time in contact with the higher shampoo inhibit the growth of shampoo for Candida sp. SGA to the media. Shampoo C labia have good inhibitory power than shampoo shampoo A and B. Keywords : anti- dandruff Shampoo, G r o w t h, Candida aIbicans
EFEKTIVITAS INFUSA KULIT JERUK PURUT (Citrus hystrix DC.) TERHADAP PERTUMBUHAN Candida albicans PENYEBAB SARIAWAN SECARA in vitro Zakiyatul Khafidhoh; Sri Sinto Dewi; Arya Iswara
PROSIDING SEMINAR NASIONAL & INTERNASIONAL 2015: Prosiding Student Paper Presentation The 2nd University Research Colloquium
Publisher : Universitas Muhammadiyah Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (235.983 KB)

Abstract

Candida albicans is a normal flora in the oral mucosa, tongue, and palate, but it could become the pathogenic one. If the amounts were excess so that it could cause thrush. Kaffir lime peel infusion contains saponins, tannins, flavonoids, coumarin which are active antifungal compound. The purpose of this study was to examine the effectiveness of kaffir lime peel infusion to the growth of Candida albicans which causes thrush with a consentration of 10%, 15%, 20% and contact time of 5 minutes, 10 minutes, 15 minutes. Method of this study used an experimental research laboratory. Suspension Candida albicans 100 mL with dilution 10-4 of McFarland 0,5 and contacted to the kaffir lime peel infusion 10%, 15%, 20% with three repetitions. After 5 minutes, 10 minutes, and 15 minutes put 100 μL and then inoculated into SGA antibiotics then incubated at 37˚C for 48 hours. Based on the results of this study concluded that kaffir lime peel infusion can inhibit the growth of Candida albicans. The best results was the 20% consentration and contact time of 15 minutes with an average colonies of 3×104 CFU/100 μL. The higher consentration of kaffir lime peel infusion the more able to inhibit the growth of Candida albicans and the longer the contact time kaffir lime peel infusion, the more can inhibit the growth of Candida albicans.Keywords: Infusion, Citrus hystrix DC., Candida albicans.
DAYA HAMBAT INFUSA BIJI PINANG (Areca catechu L.) TERHADAP BAKTERI Staphylococcus aureus Maryam Ulfah Wael; Sri Sinto Dewi; Endang Tri Wahyuni Maharani
PROSIDING SEMINAR NASIONAL & INTERNASIONAL 2017: Prosiding Seminar Nasional Pendidikan, Sains dan Teknologi
Publisher : Universitas Muhammadiyah Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (343.321 KB)

Abstract

The objective of this research is to measure and analyze the difference of inhibition concentration of areca nuts concentration 2%b/v, 3%b/v, 4%b/v,5%b/v and 6%b/v on the growth of S.aureus. The sample used in this research isareca nuts (Areca catechu L.) with the object of research S.aureus that hasequalized turbidity with Mc Farland standard 0.5. Antibacterial testing is doneby diffusion method (wells). The results showed that areca nuts can inhibitS.aureus bacteria with area of inhibit zone for concentration 2% b/v, 3% b/v,4% b/v, 5% b/v and 6% b/v is 14,5 mm, 14,6 mm, 16 mm, 18 mm and 18 mm.Result of normality test Kolmogorov-Smirnov S.aureus (p=0,691) the valuesobtained are normally distributed. The homogenity test of S.aureus is nothomogeneous, Then proceed with non parametric test that is Kruskal Wallis(p=1,000) the values obtained showed no significant difference to meaninhibition zone diameter between concentrations 2%b/v, 3%b/v, 4%b/v, 5%b/vand 6%b/v areca nuts infusion against S. aureus bacteria. Keywords: Areca nuts infusion, Staphylococcus aureus, Inhibition
AKTIVITAS Lactobacillus plantarum ISOLAT ASI TERHADAP IMUNOGLOBULIN (IgA , IgG)PADA TIKUS WISTAR MODEL SEPSIS Sri Sinto Dewi; Herlisa Anggraini
PROSIDING SEMINAR NASIONAL & INTERNASIONAL 2015: Prosiding Bidang MIPA dan Kesehatan The 2nd University Research Colloquium
Publisher : Universitas Muhammadiyah Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (222.58 KB)

Abstract

Lactat acid bacteria which act as a probiotic was a bacteria who can survive to low pH (gastric acid) and bile. Indigenous lactat acid bacteria have a potency as a Immunostimulator for Immunoglobulin (IgA,IgG) lactat acid bacteria used in this research were isolated from breastmilk (ASI). The purpose of this studi were to understand the immunostimulan effect in wistar rat after affected by the pathogen bacteria, and to get the Lactobacillus plantarum suplementation from breastmilk isolate with Elisa methode. The result of study showed that Lactobacillus plantarum from breastmilk could increase the immunoglobulin (IgA,IgG) in wistar rat and have a potency as a ImmunostimulanKeyword : Lactobacillus plantarum, Imunoglobulin (IgA,IgG)
Streptolysin Encoding Genes sagC and sagD as Biomarkers of Fish Pathogen Streptococcus iniae: An In Silico Study Stalis Norma Ethica; Sri Darmawati; Sri Sinto Dewi; Nurrahman Nurrahman; Ayu Rahmawati Sulistyaningtyas
Squalen, Buletin Pascapanen dan Bioteknologi Kelautan dan Perikanan Vol 15, No 1 (2020): May 2020
Publisher : Research and Development Center for Marine and Fisheries Product Processing and Biotechnol

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (576.394 KB) | DOI: 10.15578/squalen.v15i1.416

Abstract

Streptococcus iniae has been notorious as a serious tilapia fish pathogen leading to many disease outbreaks in warm water marine aquaculture. An in silico investigation about the potential of virulence genes of S. iniae, sagC and sagD, as biomarkers of the bacterial species, has been carried out. The aim was to determine bacterial biomarkers, which are important to facilitate early rapid diagnosis of S. iniae streptococcal infection in fish and also in humans. First, specific primers were designed from sagC and sagD genes of S. iniae SF1 genomic DNA using Primer3Plus. Next, in silico PCR (Polymerase Chain Reaction) analysis was carried out using the newly designed primers and 117 genomic DNA of streptococci (all species) retrieved from the database. Primers designed from sagC and sagD genes (SagCF: ‘5- TGCTGACCTCCTAAAAGGGC -3’ and SagCR: ‘5- CTATGCGGCGGGTTTAAGGT -3’ as well as SagDF: 5’- GCCAATCCAATCCTGTCATGC -3’ and SagDR: 5’- TGCAGCTTCCATAACCCCTC -3’) could result in a single band of each matching to 558-bp and 590-bp PCR products only from S. iniae. From 116 other streptococcal genomes studied using similar primers have resulted in no amplicon bands. A further check showed that the amplicons were truly part of sagC and sagD genes of S. iniae. These results showed that sagC and sagD genes appeared to be biomarkers of S. iniae, which are potential to be used to facilitate rapid diagnostic of the pathogenic bacterium.
Pelatihan Pengemasan Yogurt dengan Mesin Cup Sealer bagi Kelompok Ibu Rumah Tangga di Desa Sruni, Musuk, Kabupaten Boyolali Sri Sinto Dewi; Stalis Norma Ethica; Ayu Rahmawati Sulistyaningtyas; Yuni Nurkuntari; Wikanastri Hersoelistyorini
Prosiding Seminar Nasional Unimus Vol 2 (2019): Tantangan Implementasi Hasil Riset Perguruan Tinggi untuk Industrialisasi
Publisher : Universitas Muhammadiyah Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Desa Sruni yang berada di Kecamatan Musuk merupakan produsen utama susu sapi segar yang sangat potensial. Namun upaya mengolah susu segar menjadi yogurt untuk meningkatkan nilai tambah ekonominya dan dapat dijual belum dilakukan. Sebelumnya, penyuluhan tentang pentingnya pembuatan yogurt dari susu sapi segar telah dilaksanakan di Desa Sruni. Namun Masyarakat Desa Sruni belum mengetahui cara pengemasan yogurt yang layak jual. Oleh karena itu, melalui program pelatihan pengemasan yogurt, pemberdayaan masyarakat perlu dilakukan. Pelatihan pengemasan yogurt dan pemberian bantuan berupa alat cup-sealer telah diberikan kepada kelompok ibu rumah tangga yang beranggotakan 12 orang di Desa Sruni pada bulan September 2019.Kegiatan ini merupakan bagian dari pelaksanaan Program Kemitraan Masyarakat dengan dana hibah dari Kemenristek Dikti tahun 2019. Pelatihan diakhiri dengan penyerahan alat cup sealer telah dilakukan ketua salah satu Kelompok Dasa Wisma ibu-ibu rumah tangga yang ada di Desa Sruni, yaitu Ibu Sulasdi. Kegiatan acara serah terima alat ini disaksikan oleh seluruh peserta pelatihan pengemasan yogurt yang ada. Evaluasi kegiatan dilakukan dengan menguji langsung kemampuan setiap peserta pada akhir sesi pelatihan dalam menggunakan mesin cup sealer. Dari kegiatan pengabdian masyarakat ini dapat disimpulkan bahwa pelatihan pengemasan yogurt yang dilakukan mampu meningkatkan ketrampilan kelompok ibu rumah tangga di Desa Sruni dalammenggunakan mesin cup sealer.Kata kunci: Pelatihan pengemasan, mesin cup sealer, yogurt, ibu rumah tangga, Desa Sruni
Co-Authors Amal Ma’ruf Andri Cahyo Kumoro Ariyani . . Arya Iswara Ayu Rahmawati Sulistyaningtyas Didik Sumanto Endang Tri Wahyuni Maharani Fandhi Adi Wardoyo Herlisa Anggraini Maryam Ulfah Wael Nurrahman Nurrahman Ragil Saptaningtyas Ratih . Haribi Sri Darmawati Stalis Norma Ethica Tulus Ariyadi Tulus Aryadi Wikanastri Hersoelistyorini Yulfa Ariza Masruro Yuni Nurkuntari Zakiyatul Khafidhoh