Article Per Year (5 Year)
p-Index From 2020 - 2025
0.817
P-Index
This Author published in this journals
All Journal Jurnal Bios Logos Technomedia Journal Jurnal Pengabdian Masyarakat : Pemberdayaan, Inovasi dan Perubahan International Journal of Economic Research and Financial Accounting DIGIBE: Digital Business and Entrepreneurship Journal
Eka Julianti
Program Studi Pendidikan Biologi FKIP Untan
Religion Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Computer Science & IT Decision Sciences, Operations Research & Management Economics, Econometrics & Finance Environmental Science Immunology & microbiology Industrial & Manufacturing Engineering Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Medicine & Pharmacology Public Health Social Sciences Other

Published : 6 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 6 Documents
Search

 1 
Kajian Morfologi Daluga (Cyrtosperma merkusii (Hassk.) Schott) di Kabupaten Kepulauan Sangihe, Sulawesi Utara (Study on the morphology of daluga (Cyrtosperma merkusii (Hassk.) Schott) in Sangihe Archipelago, North Sulawesi) Julianti, Eka; Simbala, Herny E.I.; Koneri, Roni; Pelealu, Johanis
JURNAL BIOS LOGOS Vol 2, No 2 (2012): JURNAL BIOSLOGOS
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.2.2.2012.1043

Abstract

ABSTRAK Penelitian ini bertujuan untuk mempelajari morfologi daluga di Kepulauan Sangihe dan korelasinya dengan kondisi iklim setempat. Penelitian ini dilakukan di tiga lokasi yang berbeda, yaitu Tamako, Manganitu Selatan dan Tatoareng. Hasil penelitian menunjukkan bahwa daluga tumbuh pada ketinggian 3-24 m di atas permukaan laut dengan suhu udara 26 – 38 oC, suhu air 25 – 30 oC, kelembaban relatif 33 – 70 %, pH 5-7 dan salinitas 5-10 ppm. Morfologi daluga berbeda di ketiga lokasi pengamatan. Perbedaan yang dimaksud mencakup panjang dan berat helaian daun, panjang tulang daun utama, basal kiri dan kanan, tebal tulang daun bagian pangkal, jarak tulang daun lateral dan lebar celah daun, panjang dan diameter tangkai daun, jumlah duri, lebar spatha, diameter spadix, panjang bunga betina, bunga jantan dan bunga mandul, serta diameter dan berat kormus. Suhu udara dan air berkorelasi negatif dengan diameter kormus, tetapi kelembaban berkorelasi positif dengan diameter kormus. pH berkorelasi negatif dengan berat helaian daun, salinitas berkorelasi negatif dengan lebar spatha, tetapi elevasi berkorelasi positif dengan lebar spatha. Kata kunci: daluga, kondisi iklim, morfologi ABSTRACT This research aimed to study daluga morphology in Sangihe Archipelago and the correlation of morphology and climate conditions. The research was conducted in  three different locations, i.e. Tamako, South Manganitu and Tatoareng. The result showed that daluga grew at 3 – 24 m above the sea level with the air temperature 26 – 38 oC, water temperature 25 – 30 oC, relative humidity 33 – 70 %, pH 5-7 and salinity 5 – 10 ppm. There are some morphological differences of daluga in Tamako district, South Manganitu and Tatoareng. These differences  included the length and weight of leaf blade, the length of the main leaf blade, left and right basal, the thickness of base blade, the distance between lateral blade and leaf sinus denuding, the length and diameter of petiole, number of spines, spatha width, spadix diameter, flowers length, diameter and weight of cormus. The temperature of air and water were negatively correlated with diameter cormus, but the humidity was positively correlated with the cormus diameter. pH was negatively correlated with the weight of leaf blade, the salinity was negatively correlated with the spatha width, but the elevation was positively correlated with the spatha width. Keywords: daluga, climate condition, morphology
DNA Barcoding Tanaman Daluga (Cyrtosperma spp) dari Kepulauan Sangihe Berdasarkan Gen matK (DNA Barcoding Daluga Plant (Cyrtosperma spp) of Sangihe Island Based on matK Gene) Julianti, Eka; Pinaria, Arthur; Lengkong, Edy F; Kolondam, Beivy J
JURNAL BIOS LOGOS Vol 5, No 2 (2015): JURNAL BIOSLOGOS
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.5.2.2015.10547

Abstract

Abstrak  Tanaman daluga (Cyrtosperma spp.) termasuk dalam famili Araceae (talas-talasan), umbinya berpotensi sebagai tanaman pangan alternatif karena mempunyai nilai gizi yang tinggi. Tanaman ini banyak terdapat di Kepulauan Sangihe. Penelitian ini dilakukan untuk mengetahui DNA barcoding daluga hijau, kuning dan belang-belang dengan menggunakan gen matK (maturase K). Ekstraksi DNA menggunakan Genomic DNA Mini Kit Plant (Geneaid), amplifikasi DNA menggunakan Kit PCR 5x FirePol Master Mix (Solis Biodyne) dan sepasang primer universal yaitu matK-3F-r (5’CGTACAGTACTTTTGTGTTTACGAG 3’) dan matK-1R-f (5’ACC CAGTCCATCTGGAAATCTTGGTTC3’). Hasil penelitian menunjukkan bahwa tanaman daluga hijau, daluga kuning, dan daluga belang-belang dari Kepulauan Sangihe memiliki sekuens DNA yang identik (kemiripan 100%). Daluga yang diteliti memiliki kemiripan sekuens dengan sampel di NCBI yaitu dengan Cyrtosperma macrotum (99,88%), Podolasia stipitata (99,50%), Dracontium polyphyllum (99,38 %), Pycnospatha arietina (99,38%) dan Dracontioides desciscen (99%). Dari hasil penelitian ini dapat disimpulkan bahwa DNA barcoding tanaman daluga dari kepulauan Sangihe berdasarkan gen matK belum dapat membedakan variasi intraspesies. Kata kunci: daluga, dalugha, Cyrtosperma spp. Abstract  Daluga (Cyrtosperma spp.) plant belongs to the family Araceae, the corm is potential as an alternative food because it has a high nutritional value. The plant is widely available in Sangihe Island. This study aimed to determine the DNA barcoding of green daluga, yellow daluga and mottled daluga using matK gene (maturase K). The DNA extraction used Genomic DNA Mini Kit Plant (Geneaid) and DNA amplification used the Kit PCR 5x FirePol Master Mix (Solis Biodyne) and universal primers matK-3F-R (5' CGTACAGTACTT TTGTGTTTACGAG 3') and matK-1R-f (5'ACCCAGAAATGGATCTCTTCCTGG TTC3'). The result showed that the green daluga, yellow daluga and mottled daluga from Sangihe Islands were identical (100% similarity). Daluga from Sangihe had similarities with the sample sequences in NCBI, namely Cyrtosperma macrotum (99.88%), Podolasia stipitata (99.50%), Dracontium polyphyllum (99,38%) Pycnospatha arietina (99.38%) and Dracontioides desciscen (99%). From these results it could be concluded that DNA barcoding of daluga plant from Sangihe based on the matK gene could not  distinguish variations intraspesies. Keywords: daluga, dalugha, Cyrtosperma spp.
Penerapan Konsep Internet of Things pada Pengembangan Aplikasi Portal Alumni di Universitas Terbuka Arif, Erman; Julianti, Eka; Paulina Soko, Imelda
Technomedia Journal Vol 7 No 3 Februari (2023): TMJ (Technomedia Journal)
Publisher : Pandawan Incorporation, Alphabet Incubator Universitas Raharja

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (620.056 KB) | DOI: 10.33050/tmj.v7i3.1915

Abstract

The internet of things is one of the pillars of Industry 4.0 so that competence in concepts and practices is very useful. Alumni are an inseparable part of the world of education, but often the existence of alumni is not well organized, so there is still a mismatch of alumni data with the existing reality. Every year, the Open University graduates thousands of students from various study programs. After graduating from college, data and information about Alumni are difficult to obtain and communication between alumni is not going well, because currently UT does not have an alumni portal like some other universities have. so that with this Portal alumni can communicate well and exchange information. Currently UT Alumni only exchange information through social media such as WhatsApp Group, Facebook, etc. And this cannot be controlled by UT. Therefore we need a Portal that is able to be a solution to these problems. This study aims to create an Alumni Portal with the application of the Internet of Things in the form of an online website using the Research and Development (R&D) method. Application development is limited to prototypes because further study is required for implementation.
STRATEGI PENGUATAN PASAR UANG DAN VALUTA ASING SYARIAH SEBAGAI PILAR EKONOMI BERKELANJUTAN DI INDONESIA Julianti, Eka
Digital Business and Entrepreneurship Journal Vol. 3 No. 1 (2025): Digital Business and Entrepreneurship Journal
Publisher : FAKULTAS EKONOMI DAN BISNIS UNIVERSITAS KUNINGAN

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25134/digibe.v3i1.197

Abstract

Ekonomi syariah telah menjadi alternatif sistem ekonomi yang menawarkan stabilitas dan keberlanjutan di tengah tantangan resesi global. Pasar uang dan valuta asing syariah memainkan peran penting dalam menciptakan stabilitas keuangan yang sesuai dengan prinsip syariah, seperti keadilan dan transparansi. Namun, daya saing sektor ini masih menghadapi berbagai tantangan, termasuk keterbatasan regulasi, literasi keuangan yang rendah, serta keterbatasan diversifikasi produk. Penelitian ini bertujuan untuk mengeksplorasi strategi penguatan pasar uang syariah dan valuta asing melalui pendekatan deskriptif kualitatif berbasis literatur. Hasil penelitian menunjukkan bahwa penguatan regulasi, pengembangan literasi keuangan syariah, diversifikasi produk seperti Sukuk dan Green Sukuk, serta kolaborasi internasional melalui standar Organisasi Kerja Sama Islam (OKI) dapat meningkatkan daya saing sektor keuangan syariah di tingkat global. Penelitian ini juga menyoroti pentingnya inovasi produk keuangan syariah dalam mendukung pertumbuhan ekonomi inklusif dan berkelanjutan. Dengan menerapkan strategi ini secara holistik, pasar keuangan syariah Indonesia dapat semakin berkontribusi dalam mendukung stabilitas ekonomi nasional serta memperkuat posisinya di tingkat global. Temuan ini diharapkan dapat memberikan kontribusi signifikan terhadap penguatan sektor keuangan syariah sebagai pilar utama pembangunan ekonomi Indonesia. Kata kunci: keuangan syariah; pasar uang syariah; valuta asing syariah; inklusi keuangan; ekonomi berkelanjutan.   Abstract Islamic economics has become an alternative economic system that offers stability and sustainability amidst the challenges of global recession. The Islamic money and foreign exchange markets play a crucial role in creating financial stability that aligns with Islamic principles, such as justice and transparency. However, this sector still faces various challenges, including regulatory limitations, low financial literacy, and a lack of product diversification. This study explores strategies for strengthening the Islamic money and foreign exchange markets through a qualitative descriptive approach based on literature. The findings suggest that enhancing regulations, developing Islamic financial literacy, diversifying products such as Sukuk and Green Sukuk, and fostering international collaboration through the standards of the Organization of Islamic Cooperation (OIC) can enhance the competitiveness of the Islamic financial sector globally. The study also emphasizes the importance of innovation in Islamic financial products to support inclusive and sustainable economic growth. By implementing these strategies holistically, Indonesia's Islamic financial market can contribute significantly to national economic stability and strengthen its position on the global stage.  These findings are expected to substantially boost the Islamic financial sector as a key pillar of Indonesia's economic development. Keywords: Islamic finance; Islamic money market; Islamic foreign exchange market; financial inclusion; sustainable economy.
The Effect Of Current Ratio, Debt To Equity Ratio, And Price To Book Value On Financial Performance Of Property And Real Estate Sector Companies Listed On The Indonesia Stock Exchange In 2021-2023 Julianti, Eka; Rita Friyani; Eko Prasetyo
International Journal of Economic Research and Financial Accounting Vol 3 No 4 (2025): IJERFA JULY 2025
Publisher : CV. AFDIFAL MAJU BERKAH

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.55227/ijerfa.v3i4.367

Abstract

This study examines the influence of the Current Ratio, Debt to Equity Ratio, and Price to Book Value on the financial performance of property and real estate companies listed on the Indonesia Stock Exchange during the period 2021 to 2023. Financial performance is measured using Return on Assets (ROA), while the independent variables consist of Current Ratio (CR), Debt to Equity Ratio (DER), and Price to Book Value (PBV). The study employs a quantitative method with an explanatory approach and uses secondary data from 83 companies over three years, resulting in 249 firm-year observations. Multiple linear regression analysis was used to examine the relationships among variables, with the assistance of SPSS software. The results show that simultaneously, CR, DER, and PBV have a significant effect on financial performance. Partially, CR and PBV have a positive and significant effect, while DER has a negative and significant effect on ROA. These findings highlight the importance of liquidity, capital structure decisions, and market valuation in enhancing company profitability. This study contributes to financial decision-making practices for company management and investors in the property and real estate sector.
Pengembangan Website dan Media Sosial Untuk Masjid Jami’ Daaruttaqwa Kelurahan Pondok Cabe Ilir, Kecamatan Pamulang, Provinsi Banten Sufandi, Unggul Utan; Kosasih, Fauzy Rahman; Julianti, Eka; Sapriya, Danang
Jurnal Pengabdian Masyarakat: Pemberdayaan, Inovasi dan Perubahan Vol 4, No 5 (2024): JPM: Pemberdayaan, Inovasi dan Perubahan
Publisher : Penerbit Widina, Widina Media Utama

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.59818/jpm.v4i5.814

Abstract

This community service program (PkM) entitled “PkM Masjid Daaruttaqwa Website Development (First Year)” aims to train the Mosque Management/ Mosque Prosperity Council (DKM)/ Takmir/ Mosque Youth in managing the mosque's website. The program involved partners from mosque management, mosque youth, and mosque construction committees. The program begins with an initial visit to analyze the situation and community needs in the area adjacent to the main office of Universitas Terbuka. From the visit, it was identified and agreed upon that the PkM activities would focus on the development and management of the mosque's website. This is because, until now, the Daaruttaqwa Mosque in Pondok Cabe Ilir Village, Pamulang District, Banten Province did not have a website necessary for publicizing the worship and preaching activities carried out within the mosque to the surrounding community and congregation at large. After the mosque website development is completed, training on managing and filling the website content will be conducted by the partners. This will ensure that the mosque's website becomes rich in relevant information and can be utilized by the congregation and public.ABSTRAKProgram pengabdian kepada masyarakat (PkM) dengan judul “PkM Pengembangan Website Masjid Daaruttaqwa (Tahun Kesatu)” ini bertujuan untuk melatih Pengurus Masjid/ Dewan Kemakmuran Masjid (DKM)/ Takmir/ Remaja Masjid dalam mengelola website masjid. Kegiatan ini melibatkan mitra yang berasal dari pengurus masjid, remaja masjid, dan panitia pembangunan masjid. Kegiatan ini dimulai dengan kunjungan awal untuk menganalisis situasi dan kebutuhan masyarakat di lokasi yang letaknya berdampingan dengan kantor Universitas Terbuka pusat. Dari hasil kunjungan berhasil diidentifikasi dan disepakati bahwa kegiatan PkM difokuskan pada pengembangan dan pengelolaan website masjid karena selama ini Masjid Daaruttaqwa Kelurahan Pondok Cabe Ilir, Kecamatan Pamulang, Provinsi Banten belum memiliki website yang diperlukan untuk mensosialisasikan kegiatan ibadah dan dakwah yang dilaksanakan di lingkungan masjid tersebut agar dapat terpublikasi kepada masyarakat sekitar dan jamaah secara luas. Setelah pengembangan website masjid selesai, selanjutnya dilaksanakan pelatihan pengelolaan dan pengisian konten website oleh mitra sehingga website masjid menjadi kaya informasi yang relevan dan dapat dimanfaatkan oleh jamaah dan masyarakat umum.
Co-Authors arif, erman Arthur G. Pinaria BEIVY JONATHAN KOLONDAM Edy F Lengkong, Edy F Herny E.I. Simbala Imelda Paulina Soko, Imelda Johanis Pelealu Kosasih, Fauzy Rahman P. Eko Prasetyo Rita Friyani Roni Koneri Sapriya, Danang Unggul Utan Sufandi