cover
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kota manado,
Sulawesi utara
INDONESIA
e-Journal BUDIDAYA PERAIRAN
ISSN : 23373768     EISSN : -     DOI : -
Core Subject : Social,
e-Journal BUDIDAYA PERAIRAN merupakan jurnal ilmiah yang mempublikasikan hasil-hasil penelitian maupun ulasan (review) dibidang budidaya perairan baik budidaya air tawar, payau mapun laut. Artikel jurnal dapat ditulis dalam bahasa inggris atau bahasa Indonesia. Jurnal diterbitkan 3 kali setahun yaitu bulan Januari, Mei dan September
Arjuna Subject : -
Articles 12 Documents
Search results for , issue "Vol 1, No 3 (2013)" : 12 Documents clear
Kelayakan kualitas air kolam di lokasi pariwisata Embung Klamalu Kabupaten Sorong Provinsi Papua Barat Yumame, Rut Yullyn; Rompas, Robert; Pangemanan, Penky N.L
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2735

Abstract

The purpose of research was to analyze water quality parameters including temperature, brightness, pH, dissolved oxygen, alkalinity, and carbon dioxide in tourism area Embung Klamalu, Sorong Regency, West Papua Province. Measurement of water parameters was done in situ and in laboratory. It was found that on week two measurement, water temperature ranged from 27.2 to 28.9 ˚ C in the morning and 28.2 to 30.2 ˚C in the afternoon; brightness from 6.0 to 0.7 and from 7.0 to 7.8, pH 6.0 to 6.8 and from 7.0 to 7.8, DO from 6.10 to 7.35 mg/L; total alkalinity 100 – 160 mg /L and 100 - 140mg/L, carbon dioxide 50.92 to 85.93 mg/L and 55.90 to 75.92 mg/L. It was concluded that parameters of pond water in tourism area Embung Klamalu were still in suitable for aquaculture activity. Keywords: water quality, pond, Embung Klamalu, Sorong Regency
Potensi budidaya ikan di Waduk Embung Klamalu Kabupaten Sorong Provinsi Papua Barat: Kajian kualitas fisika kimia air Frasawi, Agustina; Rompas, Robert J; Watung, Juliaan Ch.
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2719

Abstract

The objective of this research was to measure and analyze the water quality parameters including temperature, brightness, pH, dissolved oxygen, total alkalinity, carbon dioxide and BOD in reservoir Embung Klamalu Sorong regency, and to know the factors that affected the water quality of Embung Klamalu. Measurement of water quality parameters was done in situ for temperature, brightness, pH and in laboratory for dissolved oxygen, total alkalinity, carbon dioxide, and BOD. The results showed the temperature at the five observation stations ranged from 26.2 to 29.8 0C, brightness 38 to 46 cm, pH 7.20 to 8.48 mg /L, dissolved oxygen from 7.20 to 8.48 mg / L, alkalinity 100 to 150 mg /L, carbon dioxide from 25.90 to 28.95 mg / L, BOD from 0.20 to 0.38. Refers to the standards of water quality according to the PP. 82, 2001, it could be concluded that water physical-chemical qualities in fish farming locations in the Village Klamalu were still in good condition. Keywords: Water physical-chemical quality, aquaculture, waduk Embung Klamalu
The growth of Kappaphycus alvarezii under different depth and initial weight in Talengen waters, Sangihe Islands Regency Tiwa, Richie B; Mondoringin, Lukas L.J.J; Salindeho, Indra N
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2736

Abstract

The effect of depth and weight differences on early stage of seaweed growth Kappaphycus alvarezi was studied. This Research was conducted for over 42 days, from April to May 2013 in Talengen Waters, Regency Sangihe Islands, North Sulawesi. Experiment designed used was 4 x 3 factorial experiment in a completely randomized design, so there were two factors namely depth and weight. The depth factor (D) consisted of four levels and initial weight (W) consisted of three levels, thus there were 12 treatment combination: D1W1 (25 cm, 75 g), D1W2 (25 cm, 100 g), D1W3 (25 cm, 125 g), D2W1 (75 cm, 75 g), D2W2 (75 cm, 100 g), D2W3 (75 cm, 125 g), D3W1 (125 cm, 75 g), D3W2 (125 cm, 100 g), D3W3 ( 125 cm, 125 g), D4W1 (175 cm, 75 g), D4W2 (175 cm, 100 g), and D4W3 (175 cm, 125 g). Data collected were analyzed statistically using the statistical program JMP (SAS Institute). Statistical analysis showed there was a significant differences in relative growth of seaweed K. alvarezii (P> F.0003 <.01).The best relative growth of seaweed K. alvarezzi was achieved in treatment combination D1W1 (25 cm, 75 gr) as much as 302.89%. Keywords: Seaweed, Kappaphycus alvarezii, relative growth
Kelayakan lokasi budidaya ikan di Danau Tondano ditinjau dari parameter fisika kimia air Kamsuri, Agus I; Pangemanan, Penky N.L; Tumbol, Reiny A
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2732

Abstract

The purpose of this study was to determine the current condition of the water quality of Lake Tondano in terms of physical and chemical parameters in a fish farming locations on Lake Tondano waters. Determination of sampling points at each station is placed vertically at three predetermined points from the guard house toward the front of the net, the distance between one point to the next point was ± 10 m; whereas for the analysis of water quality parameters was done in Clinical Pathology of Fish Diseases Laboratory, Faculty of Fisheries and Marine Science, Sam Ratulangi Manado and Manado Industrial Research and Standards Laboratory. Determination points were done by purposive sampling which refers to the physiographic location wherever possible in order to represent or describe these waters. The research was carried out for 6 weeks and was done in 2 stages, morning and afternoon. For direct measurement (in situ) was performed once a week which included parameters DO, pH, temperature, and brightness, while the laboratory tests were conducted for 2 weeks which included parameters Nitrite, Nitrate, Iron, Chlorine, Manganese, Chloride, Sulfate, Aluminum, ammonia and Phosphate. The results show that the locations of the four parameters of chlorine (CL2) with range (0.1 to 0.28) and the parameters of Ammonia with the range (0.0125 to 0.15) over the limit indicated on water quality standards. The parameters of temperature, DO, pH, brightness, nitrate, nitrite, sulfate, manganese, chloride, aluminum, iron and phosphate were still in the water quality standard PP No.82 of 2001.
Analisis finansial usaha budidaya rumput laut berdasarkan uji pertumbuhan bibit dengan dengan jarak ikat berbeda Gaghaube, Agus; Ngangi, Edwin L.A; Mudeng, Joppy D. Mudeng D
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2737

Abstract

The purpose of this study was to analyze the financial feasibility of the test Kappaphycus alvarezii seaweed cultivated with different seed tight distance. The study was conducted in Talengen Bay, Tabukan Tengah, Regency of Sangihe Islands from April to May 2013. Seed tight distance as treatment consisted of A = 10 cm, B = 20 cm, and C = 30 cm. Seaweed was cultivated using surface long-line with initial weight of seed per bond was 100 g. Containers measuring 16 x 10 m² were divided into nine small plot of 4 x 2 m² , each with three ris. The trial was conducted for over 42 days, and weighed every 14 days. Results obtained displayed the best growth was achieved at treatment C (distance of 30 cm) followed by distance of 20 cm, and 10 cm. Analysis of total revenue (total profit) found that seedlings 10 cm distance seed tight was the highest, followed by distance 20 cm and 30 cm. Income level analysis results (profit rate) found that 30 cm distance was the highest, followed by distance 10 cm and 20 cm. As conclusion, the cultivation of seaweed K. alvarezzi was financially viable based on 30 cm seed tight distance. Keywords: Kappaphycus alvarezii, total profit, profit rate, Talengen Bay
Pengaruh beberapa jenis pakan hijauan terhadap pertumbuhan ikan Koan Stenopharyngodon idella Babo, Desmianti; Sampekalo, Julius; Pangkey, Henneke
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2716

Abstract

The aim of this research was to determine effect of feed plants on growth of grass carp, Stenopharyngodon idella. Grass carp used had an average length of 12.8 cm and weight of 21.00 g. Fish were kept in 12 pouch nets with a density of 8 fish/net. Fish was fed in et libithum, twice a day. This research used Completely Randomized Design with four treatments: A Pennistum purpureum, B Eichornia crassipes, C Pistia stratiotes and D Azolla pinnata, each with three replications. Data from each treatment were statistically analyzed using analysis of variance and LSD. Research results showed that growth of fish in treatment C was significantly different as compared to other treatments. Length of fish reached 3.30 cm, absolute growth 22.12 g and relative growth achieved 103.60%. thus, application of feed plant Pistia stratiotes might improved growth of grass carp.
Molecular identification of pathogenic bacteria and PCR specific primer design Aris, Muh.; Sukenda, Sukenda; Harris, Enang; Sukadi, Muh. Fatuhcri
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2733

Abstract

Management of healthy seaweed aquaculture and control of ice ice disease are important component in seaweed production. To support the integrated prevention of ice ice disease, information about genetic variation of bacterial pathogen and the availability of fast and accurate detection are required. This study aimed to identify bacterial pathogen based on gene sequence analysis 16S-rRNA, construction of specific PCR primer from gene sequent analysis 16S-rRNA from bacteria that had the highest pathogenicity. Gene 16S rRNA of bacteria that had the highest pathogenicity was amplificated with universal primer PCR domain forward primer 63f (5’-CAG GCC TAA CAC ATG CAA GTC-3’) and reverse primer 1387r (5’-GGG CGG WGT GTA CAA GGC-3’). DNA Sequence obtained was compared to data base European Bioinformatics Institute (EBI) BLASTN. Construction and feasibility analysis of primer pair was done using primer 3 program. Two specific primer PCR were successfully constructed namely aSEFM-F (5- CAGCCACACTGGAACTGAGA-3) and aSEFM-R(5 TTAGCCGGTGCTTCTTCTGT -3). Both primer reacted optimum at 60°C and produced 201 bp amplicon. Keywords: pathogenicity, gene 16S-rRNA, PCR, primer, specific
The effect of immersion in different doses of methyl testosteron hormone on survival and growth of nile tilapia larvae, Oreochromis niloticus Matheos, Refli; Watung, Juliaan Ch.; Kalesaran, Ockstan
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2734

Abstract

This study aimed to determine the effect of methyl testosterone hormone for immersion of tilapia larvae for 8 hours on survival rate and growth of tilapia larvae (Oreochromis niloticus). Test animals used were as many as 240 larvae of tilapia, with methyl testosterone hormone treatment as much as A = 0 mg / l, B = 1,5 mg / l, C = 2,5 mg / l, and D = 3,5 mg /. Survival rate of tilapia larvae live on the highest dose of 1.5 mg / l which is 93.33% (A) followed by 83.3% (C), 80% (A), 75% (D). Highest absolute growth of larvae at the 2,34 cm (D) followed at 2,23 cm (C), 2,21 cm (B), 2,13 cm (A). The results showed that the differences in the dose of methyl testosterone did not give significantly different effect on survival rate of larvae and absolute growth. Keywords: immersion, methyl testosterone hormone, Oreochromis niloticus, survival
Pertumbuhan ikan kuwe putih Caranx sexfasciatus di karamba jaring apung yang diberi pakan rucah dengan bahan tambahan yang berbeda Mansauda, Grace F; Sampekalo, Julius; Lumenta, Cyska
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2745

Abstract

The use of trash fish ( Treatment A ), trash fish + cassava( Treatment B), pellets+ trash fish ( Treatment C ) and a mixture of trash fish + cassava + pellets ( Treatment D ) as feed had been conducted to evaluate its effect on growth of Caranx sexfasciatus. This research was carried out inTelengen Bay waters, Central Tabukan District, Sangihe Islands Regency. Fish with weighing 60,9 -62,9 g were distributed in 12 net cages measuring 3x1x1 m with the density of 5 fish each. Fish were fed three times a day for seven weeks. Fish weight was measured every week. At the end of experiment, the individual weight of fish ranged from 168,7 to 222,8 g in with the highest average weigth gain was achieved in treatment A namely 222.8 g (354.2%)), followed by treatment C 178.0 g (286.6 %) treatment D 170.08 g (280.5%), and treatment B as much as 168.7 g (274.3%). Statistical analysis displayed that weight gain of fish in treatment A was significantly different as compared to that of treatments B, C, and D. There was no significant differencesbetween treatment B, C, and D. Food conversion ratio of treatment A was significantly different compared to other treatments. Food conversion ratio of treatment A was 2.80, B 4.25, C 3.70, D 3.88. as conclusion, the use of trash fish without supplementaion with others ingradients resulted in the highest absolute and relatif growth of fish and the lowest food conversion ratio of 2.80 as compared to other treatments. Keywords: Caranx sexfasciatus, weight gain, food conversion ratio, floting net cage
Evaluasi Kualitas, Kuantitas Telur Dan Larva Ikan Patin Siam (Pangasianodon Hiphopthalmus) Dengan Penambahan Ovaprim Dosis Berbeda Manantung, Vina O; Sinjal, Hengky J; Monijung, Revol D
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2718

Abstract

This study was conducted to determine the effect of different doses of ovaprim on latency time of spawning, hatching rate, and survival of fish larvae (Pangasianodon hiphopthalmus). Experimental design used was Randomized Complete Design (CRD) with four treatments, each with three replication. The treatments including 0 ml, 0.3 ml, 0.6 ml and 0.9 ml ovaprim per kg of body weight of fish. Data collected consisted of latency time of spawning, hatching rate, and survival rate of larvae. The results showed that treatment with different doses of ovaprim hormones resulted in a significant influence on latency time of spawning, egg hatchability and survival rate of larvae. It was found that 0.6 ml ovaprim could increase the latency time of spawning, egg hatchability and survival rate of larvae. The average latency time of larvae was 529 minutes, hatching rate was 80,86% and survival rate of larvae was 83,33%.

Page 1 of 2 | Total Record : 12